JAFC-普洱茶抗乙肝

Published: August 28, 2011 r 2011 American Chemical Society 9927 dx.doi.org/10.1021/jf202376u | J. Agric. Food Chem. 2011, 59, 9927–9934 ARTICLE pubs.acs.org/JAFC Inhibition of the Replication of Hepatitis B Virus in Vitro by Pu-erh Tea Extracts Shaobo Pei,† Yong Zhang, Hao Xu, Xinwen Chen, and Shiyun Chen* State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China ABSTRACT: Hepatitis B virus (HBV) is one of the most widespread viral infections in the world and poses a significant global public health problem. The implementation of effective vaccination programs has resulted in a significant decrease in the incidence of acute hepatitis B. Nevertheless, there is still a need for asmany effective anti-HBV drugs as possible. In this study, the role of pu-erh tea extracts (PTE) against HBV was analyzed in vitro by using a stably HBV-transfected cell line HepG2 2.2.15. The MTT assay showed that PTE and its active components (tea polyphenols, theaflavins, and theanine) presented low cytotoxicity. ELISA analysis revealed that PTE effectively reduced the secretion of HBeAg, but any one of the active components alone showed weaker efficacy, suggesting that the anti-HBV activity of PTE might be a synergetic effect of different components. RT-PCR and luciferase assay showed that PTE suppressed HBV mRNA expression while leaving four HBV promoter transcriptional activities unchanged. Fluorescence quantitative PCR results demonstrated that PTE dramatically diminished HBVDNA produced in cell supernatants as well as encapsidated DNA in intracellular core particles. Finally, PTE significantly reduced intracellular reactive oxygen species (ROS) level. This study is the first to demonstrate that PTE possesses anti-HBV ability and could be used as a potential treatment against HBV infection with an additional merit of low cytotoxicity. KEYWORDS: hepatitis B virus (HBV), pu-erh tea extracts (PTE), anti-viral activity ’ INTRODUCTION The hepatitis B virus (HBV) belongs to Hepadnaviridae, and its infections are the most common causes of liver disease world- wide. Over 350million people worldwide are chronically infected with this virus, which can be transmitted parenterally, sexually, or perinatally.1 Acute HBV infection occasionally results in fulminant hepatitis and usually progresses to a chronic state, which likely leads to decompensated cirrhosis and hepatocellular carcinoma (HCC).2 After several decades of HBV infection, liver cirrhosis appears in 30�40% of infected persons and HCC develops in 1�5% of cirrhotic patients.3 Studies have shown that >50% of the registered cases of HCC are associated with HBV infection.4,5 Even worse, HCC is the third leading cause of death after of lung and stomach cancers in the world, and each fifth diagnosed tumor in the world is HCC.6,7 The implementation of effective vaccination programs has resulted in a significant decrease in the incidence of acute hepatitis B. Interferonα and nucleotide/nucleoside analogues are widely used in controlling the progression of chronic hepatitis B. However, the immunomodulator interferon α is less effective in curingHBV infection and has some adverse effects.8Nucleotide/ nucleoside analogues could selectively inhibit the viral polymer- ase with reverse transcriptase, but long-term therapymight lead to replication of resistant HBV strains.9 It is therefore urgent to find new antiviral agents for the treatment of HBV infection. Tea is one of the healthiest and most popular beverages, offer- ing many health benefits. Compared with green tea (unfermented tea), oolong tea (half-fermented tea) and black tea (full-fermented tea),10 pu-erh tea is one kind of postfermented tea, which undergoes secondary fermentation and oxidation. Studies have revealed that pu-erh tea has many potential functions, for example, anticancer,11 antioxidant,12 antiobesity,13 antimutagenic, antimicrobial,14 anti- arteriosclerosis,15 and antihyperlipogenesis.16 However, the che- mical composition in pu-erh tea is complex. It is difficult to isolate pure ingredients for structural and functional characterization.17 Several components of pu-erh tea have been characterized, for example, tea polyphenols (TP), theaflavins (TF), and theanine. TP, which are also known as catechins, possess several activities such as antivirus infection18,19 and antioxidation and antitumor actions.20 TF have also been confirmed to have antioxidation21 and inhibit SARS-CoV 3C-like protease activity.17 Theanine, which is a green tea-derived amino acid, has been demonstrated to have anxiolytic effects22 and protects against virus infection.23 The aim of the present study was to investigate the anti-HBV ability of the extracts from pu-erh tea. We also tested the roles of three major components (TP, TF, and theanine) in pu-erh tea on HBV replication. We used a stably HBV-transfected cell line, HepG2 2.2.15. HBV antigens, HBV mRNA, HBV gene tran- scriptional activity, extracellular HBV DNA, encapsidated DNA in intracellular core particles, and ROS level were detected. Our results indicate that PTE effectively inhibits HBV replication, whereas TP, TF, or theanine alone did not function well as PTE, suggesting that the anti-HBV capacity of PTE might be a com- bination of several chemicals. ’MATERIALS AND METHODS Preparation of Chemicals. Pu-erh tea extracts (PTE), tea poly- phenols (TP, 99.40%), and theaflavins (TF, 61.2%) used in this study were all purchased from Gosun Biotechnologies Co., Ltd. (Hangzhou, China). PTE were dissolved in cell culture medium; TP and TF were dissolved in DMSO. Theanine (99.3%) was purchased from Wuxi Received: June 16, 2011 Revised: August 27, 2011 Accepted: August 27, 2011 9928 dx.doi.org/10.1021/jf202376u |J. Agric. Food Chem. 2011, 59, 9927–9934 Journal of Agricultural and Food Chemistry ARTICLE Southern Yangtze University Biotech Co., Ltd., and dissolved in cell cul- ture medium. All of the stock solutions were freshly prepared immedi- ately before use and were diluted to different concentrations as desired with cell culture medium. Component Analysis by HPLC. The analysis of the components of PTE and the proportion of theanine in PTE was performed on an Agilent 1200 series HPLC using a reversed-phase column (5 μm, 4.6� 250 mm). Theanine and PTE were dissolved in 0.05% trifluoroacetic acid/acetonitrile (95:5). A gradient consisting of eluant A (0.05% trifluoro- acetic acid) and eluant B (acetonitrile) was applied at a flow rate of 1.2 mL/min as follows: 5% B constant from 0 to 10 min, 5� 100% B linear from 10 to 12 min, and 5% B constant from 12 to 15 min. The UV detector was set at 203 nm. Cell Line and Culture Conditions. The human hepatoblastoma cell line HepG2 2.2.15, which was stably transfected with four 50�30 tandem copies of HBV genome,24 was used in this study. Cells were maintained in DMEM (Gibco) supplemented with 100 μg/mL penicillin, 100 μg/mL streptomycin, 500 μg/mL G418, and 10% fetal bovine serum (Gibco) at 37 �C in an incubator with 5% CO2. MTT Assay. The cytotoxicity effect of the chemicals to HepG2 2.2.15 cells was detected by evaluating the viability of cells through the MTT assay. For each well of 96-well plates, 4� 104 HepG2 2.2.15 cells were added and cultured at 37 �C for 24 h. The medium was replaced with fresh medium containing PTE, TP, TF, or theanine of different concentrations at an interval of every 2 days. The control wells contained an equivalent amount of solvent. Six days later, the culture medium was replaced with 0.5 mg/mL MTT (Sigma-Aldrich). After incubation at 37 �C for 4 h, the supernatant was aspirated and the formanzan particles were dissolved by adding 150 μL of DMSO. When the precipitant was completely solubilized, the absorbance at wavelengths of 490 and 630 nm was measured. The inhibition rates (percent) were calculated as 100% � [1 � value of the study wells (A490 � A630)/value of the control wells (A490� A630)]. The concentrations of the chemicals with an inhibition rate of 50% (CC50) were calculated according to Berkson’s method.25 The concentrations below CC50 were used in subsequent assays. Treatment of PTE, TP, TF, and Theanine on HepG2 2.2.15 Cells. For each well of 24-well plates, 1� 105 HepG2 2.2.15 cells were added and cultured at 37 �C for 24 h. The medium was replaced with fresh medium containing PTE, TP, TF, or theanine of different concentrations at an interval of every 2 days. The control wells contained an equivalent amount of solvent. Six days later, the media and cells were collected and used for further experiments. Detection of HBsAg andHBeAg in Cell Culture Supernatant. HBsAg and HBeAg in the culture medium were analyzed using a commercial ELISA kit (Kehua Bioengineering Corp., Shanghai, China) according to the instructions. The medium samples collected 6 days after treatments were centrifuged at 2000g for 10min and applied to ELISA. The samples were diluted to appropriate concentrations with PBS buffer before measurement. Inhibition rates (percent) of antigens were calculated as 100% � [1 � value of the study well (A450 � A630)/value of the control well with drug A450 � A630)]. The concentrations of the chemicals with an inhibition rate of 50% (EC50) were calculated according to Berkson’s method.25 RT-PCR Analysis of HBV mRNA. Total RNA was extracted by TRIZOL reagent (Invitrogen) according to the instructions. The samples were treated with RQ1 RNase-Free DNase (Promega) and reverse transcribed into cDNA using M-MLV RTase (Promega). The primers used for HBV mRNA analysis were HBV-X-F and HBV-X-R (Table 1), which locate at the X gene of the HBV genome. The primers β-actin-F and β-actin-R (Table 1) were used to amplify the β-actin gene, which was used as an internal reference. The PCR begins with denaturing at 94 �C for 3 min, followed by 30 cycles of 15 s at 94 �C, 15 s at 55 �C, and 15 s at 72 �C. Luciferase Activity Assay. Five putative HBV gene promoters were respectively inserted into the promoter region of a pGL3 firefly luciferase reporter vector (provided by Prof. Y. Zhu). Each of these recombined plasmids was transfected intoHepG2 2.2.15 cells by Fugene HD(Roche) alongwith the pRL-TKplasmid expressing renilla luciferase as an internal control to normalize transfection efficiency. Three hours later, Table 1. PCR Primers Used in This Study primer sequence (50f30) HBV-X-F CCTTCTTACTCTACCGTTCC HBV-X-R GACCAATTTATGCCTACAGCC β-actin-F CACCAACTGGGACGACAT β-actin-R ACAGCCTGGATAGCAACG HBV-F GTTGCCCGTTTGTCCTCTAATTC HBV-R GGAGGGATACATAGAGGTTCCTT Figure 1. Reverse-phase HPLC analysis of theanine in PTE: (A) PTE sample; (B) theanine standard sample; (C) standard curve of theanine. The chromatograms were generated using a reversed-phase column and a gradient mobile phase as described under Materials and Methods. The detection wavelength was 203 nm. 9929 dx.doi.org/10.1021/jf202376u |J. Agric. Food Chem. 2011, 59, 9927–9934 Journal of Agricultural and Food Chemistry ARTICLE the medium was replaced with fresh medium containing 320 μg/mL PTE; 48 h later, the luciferase activity was measured using a Dual-Luciferase Reporter (DLR) Assay System (Promega) following the instructions. The reporter activity was calculated as luciferase activity of reporter plasmids in cells treated with PTE compared with that in non- treated cells. Fluorescence Quantitative PCR. After PTE treatment at differ- ent concentration (0, 160, or 320 μg/mL) for 6 days, two forms of HBV DNAwere collected and analyzed. Fluorescence quantitative PCR (FQ-PCR) was applied with Syb green fluorescence dye. The primers used for FQ-PCR were HBV-F and HBV-R (Table 1). The FQ-PCR fragment was located at the HBV S gene, and the plasmid containing the cloned HBV genome was used as a standard. To analyze the HBV DNA in cell supernatants, the supernatants were centrifuged at 500g for 10 min and incubated at 55 �C for 2 h with an equal volume of lysis buffer (20 mM Tris-Cl, pH 8.0, 10 mM EDTA, 1% SDS, and 400 μg/mL proteinase K). The HBV DNA in supernatants was extracted using buffer-saturated phenol/chloroform (1:1) and incubated at�20 �C for 30 min with 2 volumes of ethanol, 0.1 volume of NaAc (3 M, pH 5.2), and 20 μg tRNA. After centrifugation at 18000g for 15 min, the pellets were washed with 70% ethanol and then dissolved in the proper volume of distilled water. To analyze the HBV encapsidated DNA from intracellular core particles, cells treated with various chemicals in 24-well plates were lysed with 400 μL of buffer (50 mM Tris-Cl, pH 7.4, 1 mM EDTA, 1% NP-40) on ice for 20 min. The lysate was centrifuged at 18000g for 1 min, and the supernatant was incubated at 37 �C for 30 min with 4 μL of 1 M MgCl2 and 4 μL of 10 mg/mL DNase I and then incubated at 55 �C for 2 hwith 20μLof 0.5MEDTA(pH8.0), 10μLof 20mg/mLproteinaseK, and 40 μL of 10% SDS. The HBV encapsidated DNA was extracted using phenol/chloroform (1:1) solution and then incubated at �20 �C for 30 min with 0.7 volume of isopropanol, 0.1 volume of 3 M NaAc (pH 5.2), and 15 μg of tRNA. After centrifugation at 18000g for 15 min, the pellets were washed with 70% ethanol and dissolved in 15 μL of distilled water. The FQ-PCR program begins with a denaturing step at 95 �C for 5min and contains 45 cycles of 10 s at 94 �C, 10 s at 57 �C, and 10 s at 72 �C. Measurement of Intracellular ROS Level. Cells were treated with (160 or 320 μg/mL) or without PTE for 6 days, washed with PBS, and incubated with probe 20,70-dichlorfluorescein diacetate (DCFH- DA) for 2 h at 37 �C. Cells were washed with PBS again and then applied to fluorescence measurements with an emission wavelength of 488 nm and an excitation wavelength of 525 nm. Statistics Analysis. Data analyses were carried out using the In- dependent Sample t test/Univariate program of the SPSS for Windows system. A P value of <0.05 was considered to be statistically significant. ’RESULTS Cytotoxicity Analysis of PTE and Its Components on HepG2 2.2.15 Cell. Tea polyphenols stably exist in PTE, where- as TF and theanine vary with tea manufacturing sources and procedures.12,26 For this study, the components of PTEwere first analyzed (Figure 1). The HPLC profile showed at least 10 peaks in the PTE sample, and other chemicals with relatively higher proportions than theanine were also found in the PTE sample (Figure 1A). Due to the lack of standard chemicals, we detected only theanine in our PTE samples (Figure 1B). On the basis of the standard curve of theanine (Figure 1C), its content in the PTE sample was calculated as 1.563%. The MTT assay was then used to analyze the cytotoxicity of PTE and its components, and the results are shown in Figure 2. As shown in Figure 2A, PTE has low cytotoxicity to HepG2 Figure 2. Cytotoxicity analysis of PTE and its ingredients: MTT assays of PTE (A), tea polyphenols (B), theaflavins (C), and theanine (D). Results are expressed as inhibition rate of control (mean ( SD) from six independent experiments. 9930 dx.doi.org/10.1021/jf202376u |J. Agric. Food Chem. 2011, 59, 9927–9934 Journal of Agricultural and Food Chemistry ARTICLE 2.2.15 cells. In the MTT assay, the OD value of cells treated with PTE varied, the inhibition rates were sometimes negative, and the CC50 of PTE could not be calculated. When the concentra- tion of PTE was at a high concentration of 320 μg/mL, the inhibition rate was only 18.5( 8.18%. Under a microscope, little cytotoxicity of HepG2 2.2.15 cells was observed even at a con- centration of 320 μg/mL PTE treatment (data not shown). For TP and TF, the CC50 values were 134.5 and 142.6 μg/mL, respectively (Figure 2B,C). Theanine also showed no obvious cytotoxicity even at relatively high concentrations of 1�2 mM (Figure 2D). PTE and Its Components Inhibit the Secretion of HBV Antigens. After treatment with different concentrations of PTE, TP, TF, or theanine, the HBV HBsAg and HBeAg secreted into the mediumwere detected by ELISA (Figure 3). PTE significantly reduced the secretion of HBeAg in a dose-dependent manner (P < 0.05, Figure 3A), and the EC50 of HBeAg was 112.2 μg/mL. PTE affected HBsAg slightly with an inhibition rate of 30.82 ( 5.32% at the concentration of 320 μg/mL. Similarly, TP and TF also significantly reduced the secretion of HBeAg (P < 0.05, Figure 3B,C), and the EC50 values were 52.93 and 70.32 μg/mL, respectively. Theanine at lower concentrations could effectively decrease HBeAg secretion (P < 0.05, Figure 3D), whereas little effect on HBsAg secretion was observed. These results suggest that PTE and its components could significantly reduce the secretion of HBeAg. Because PTE acts more effectively than others, we therefore used PTE in our subsequent studies. PTE Inhibits HBVmRNA Level.To test HBVmRNA level after PTE treatment, RT-PCR analysis was carried out. Because extracted HBV mRNA quality was not good at high PTE concentrations, we used HBV mRNA from cells treated with low PTE concentra- tions (5�20 μg/mL). As shown in Figure 4, at 6 days after the treatment of PTE on HepG2 2.2.15 cells, the HBV mRNA level was decreased compared to untreated control. This result indi- cates that the addition of PTE suppressed the transcription of HBV genome. PTE Regulates Transcriptional Activity of HBV Genes. A Dual-Luciferase Reporter (DLR) Assay System (Promega) was further applied to investigate whether PTE influenced the trans- criptional activity of the HBV genes. Four HBV gene promoters were respectively inserted into the promoter region of a pGL3 firefly luciferase reporter vector and transfected into HepG2 2.2.15 cells, with plasmid pRL-TK expressing renilla luciferase as an internal control to normalize the transfection efficiency. At 48 h after 320 μg/mL PTE treatment, the luciferase activities were measured. Compared with untreated cells, PTE regulates HBV gene promoters with a difference. PTE slightly down-regulates activities of S1 and S2 promoters (Figure 5A,B). For HBVX and C promoters, PTE slightly up-regulates their activities (Figure 5C,D). PTE Inhibits the Production of HBV DNA in Cell Super- natants and HBV Encapsidated DNA in Intracellular Core Particles. Florescence quantitative PCR (FQ-PCR) showed that PTE dramatically diminishes HBV DNA produced in cell super- natants (P < 0.05, Figure 6A). At the concentration of 160 μg/mL, PTE could inhibit 30%HBVDNA production in medium.When the PTE concentration was increased to 320 μg/mL, extracellular HBV DNA was undetectable. For PTE treatment, the EC50 of HBV DNA in cell supernatants was 205.8 μg/mL. In addition, Figure 3. ELISA analyses of HBsAg andHBeAg secreted byHepG2 2.2.15 cells. After treatment with PTE (A), tea polyphenols (B), theaflavins (C), or theanine (D), the culture medium was collected and HBsAg and HBeAg were analyzed by ELISA. Results are expressed as inhibition rates of control (mean ( SD) from three independent experiments. (/) P < 0.05 versus control group; (#) P < 0.05 versus last concentration group. 9931 dx.doi.org/10.1021/jf202376u |J. Agric. Food Chem. 2011, 59, 9927–9934 Journal of Agricultural and Food Chemistry ARTICLE FQ-PCR showed that PTE also efficiently impeded HBV en- capsidated DNA in intracellular core particles (P < 0.05, Figure 6B). At the concentrations of 160 and 320 μg/mL, PTE could inhibit 50.5 and 51.8% HBV encapsidated DNA produc- tion in intracellular core particles, respectively. PTE Reduces Intracellular ROS Levels. HBV infection will induce intracellular oxidative stress mediated by ROS and cause degenerative diseases.12,27 We finally tested whether PTE could remove the intracellular ROS in HBV-transfected cells. Inter- cellular ROS was quantified by fluorescence probe DCFH-DA. At concentrations of 160 and 320 μg/mL, PTE scavenged 40.9( 5.4 and 53.4 ( 7.8% ROS, respectively (Figure 7). This result reveals that PTE significantly reduces intracellular ROS levels in HBV-infected cells. ’DISCUSSION In this study, we used