Clinical and Electrophysiological Studies of a Family with Probable X-linked Dominant Charcot-Marie-Tooth Neuropathy and Ptosis.

Clinical and Electrophysiological Studies of a Family with Probable X-linked Dominant Charcot-Marie-Tooth Neuropathy and Ptosis. ? Original Article 489 Clinical?and?Electrophysiological?Studies?of?a?Family?with Probable?X?linked?Dominant?Charcot?Marie?Tooth Neuropathy?and?Ptosis Tony Wu, MD, DMS; Hung-Li Wang , PhD; Chun-Che Chu, MD; Jia-Ming Yu , MD; 1 2 Jeng-Yeou Chen , MD; Chin-Chang Huang, MD3 Background:?The X-linked dominant Charcot-Marie-Tooth neuropathy (CMTX) is a hereditary motor and sensory neuropathy linked to a variety of mutations in the connexin32 (Cx32) gene. Clinical and genetic features of CMTX have not previously been reported in Taiwanese. Methods: Clinical evaluations and electrophysiological studies were carried out on 25family members of a Taiwanese family group. Molecular genetic analysis ofthe Cx32 gene was performed. A sural nerve biopsy was obtained from 1patient. Results: Nine patients had clinical features of X-linked dominant inheritance and amoderate Charcot-Marie-Tooth (CMT) neuropathy phenotype. Moleculargenetic analysis showed no mutation of the Cx32 coding region, but revealeda G-to-A transition at position -215 of the nerve-specific promoter P2 of theCx32 gene. Ptosis is 1 clinical manifestation of neuropathy in this probableCMTX family. Familial hyperthyroidism is an additional independent featureof the family. Electrophysiological and histological studies showed featuresof axonal neuropathy. Multimodality evoked potential studies revealed nor-mal central motor and sensory conduction velocities. Conclusions:?The presence of ptosis in this family illustrates the existence of clinical het- erogeneity among related family members with CMTX similar to that in CMT of autosomal inheritance. Electrophysiological and histological find- ings revealed normal central conduction and axonal neuropathy. (Chang?Gung?Med?J?2004;27:489?500) Key?words:??X-linked dominant Charcot-Marie-Tooth neuropathy, electrophysiology, connexin32, ptosis, familial hyperthyroidism. C harcot-Marie-Tooth (CMT) neuropathies are a heterogeneous group of disorders characterized by degenerative changes in peripheral nerves leading to progressive distal muscle weakness, atrophy, and pathological findings, CMT neuropathies are classi- fied into a demyelinating type (CMT 1) character- ized by marked slowing of nerve conduction veloci- ties (NCVs), and an axonal type (CMT 2) with pre- sensory loss.(1,2) Based on electrophysiological and served or only mildly reduced NCVs. There are (1,2) From the First Section, Department of Neurology, Chang Gung Memorial Hospital, Taipei;1Department of Physiology, Chang Gung University;23Departmentof Neurology, Taipei Municipal Jen-Ai Hospital; Department of Endocrine and Metabolism, Chang GungMemorial Hospital, Taipei. Received: Oct. 14, 2003; Accepted: May 13, 2004 Address for reprints: Dr. Tony Wu, Department of Neurology, Chang Gung Memorial Hospital. 5, Fushing Street, Gueishan Shiang, Taoyuan, Taiwan 333, R.O.C. Tel.: 886-3-3281200 ext. 8418; Fax: 886-3-3287226; E-mail: tonywu@adm.cgmh.org.tw ? Tony Wu, et al490A Taiwanese family with CMTX and ptosis several modes of inheritance in both types: autoso-mal dominant, X-linked dominant, and autosomalthy. Most clinical and genetic studies of CMTX (22,23) are based on families from Europe or North America,but the results of a genetic study have been describedrecessive.(3,4) The most-frequent form, CMT1A, is due in most cases to a duplication of chromosome17p11.2 containing the peripheral myelin protein 22in a Taiwanese family. (24) Two hereditary diseases may coexist in a singlefamily. Independent presentations of CMT andmyotonic dystrophy, facioscapulohumeral musculardystrophy, or nephropathy in a single family groupgene (PMP22).(5,6) CMT1B results from mutations in the myelin protein zero gene (MPZ) on chromosome1.(7) X-linked dominant CMT (CMTX) is linked tomutations within the connexin32 (Cx32) locus ofchromosome Xq13.1. Cx32 is thought to functionas a gap junction protein, and to be involved in theexchange of information and metabolites in the ner-vous system. The Cx32 protein and mRNA areexpressed in Schwann cells and oligodendrocytesthat function as myelinated cells of the peripheralhave been described in family studies. The con- (25-27) currence of CMT and familial hyperthyroidism insingle families has not been reported. We encoun-tered a family affected with the unusual combinationof hereditary neuropathy, ptosis, and familial hyper-thyroidism. This study investigates the clinical, elec-trophysiological, and molecular genetic characteris-tics in this Taiwanese family group.(8-11) and central nervous system, respectively.(12,13) The severity of the CMTX phenotype is correlated withthe location and type of mutation of the Cx32METHODS gene.(14) Two CMTX families possessing mutationswithin the noncoding region of the Cx32 geneshowed a moderate phenotype. There is no consen-sus concerning the type of neuropathy. Patients Detailed histories and neurological examina-tions were obtained from the family members shownin the pedigree (Fig. 1). Most of the family membersreceived electrophysiological and molecular geneticstudies, and thyroid function tests (including T3, T4,TSH, antimicrosomal Ab, and TBII). All participantsprovided written informed consent according to the(15)(16,17) Some related individuals suffering from CMTX showed electrophysiological and pathological findings of pri- mary axonal degeneration,(3,18-21) while others were considered to have primary demyelinating neuropa- Fig.?1???Pedigree of this family with probable X-linked dominant Charcot-Marie-Tooth neuropathy and familial hyperthyroidism. The propositus is indicated by the arrow.Chang Gung Med J Vol. 27 No. 7 July 2004 ? 491Tony Wu, et alA Taiwanese family with CMTX and ptosis protocol approved by the Ethics Committee ofChang Gung Memorial Hospital, Taipei, Taiwan.Genomic DNA was extracted from peripheral bloodlymphocytes using standard methods. A sural nervebiopsy was obtained from patient III-4. Methods used for the genetic study in these fam-ily members were published elsewhere. In brief,(24) genomic DNA was isolated from venous blood withQIAGEN blood and cell culture DNA kits. A DNAfragment containing the Cx32 coding region ornerve-specific P2 promoter region of the Cx32 genewas obtained by performing PCR amplification usinggenomic DNA as the template. PCR was carried outwith the following oligonucleotide primers: (a) theforward primer for human connexin32 was 5'TGTT-TGCAGGTGTGAATGAGGCAG3' and correspond- ed to nucleotides 473 to 496 of the human Cx32gene; (b) the reverse primer for the human Cx32 cod-ing region was 5'TGGCAGGTTGCCTGGTATGTG- GCA3' and corresponded to nucleotides 1350 to1373 of the Cx32 gene; (c) the sense primer for theproximal P2 promoter was 5'GCCTCAGG-GAAAATCCTGGTGACC3' and corresponded to nucleotides -353 to -330 of the human Cx32 gene;and (d) the antisense primer for the DNA fragmentElectrophysiological????evaluation Motor nerve conduction studies including medi-an, ulnar, peroneal, and tibial nerves and sensorynerve conduction studies including median, ulnar,and sural nerves were performed as standard meth-ods described previously. Evoked potential studies (28) including brainstem auditory evoked potentials(BAEPs), pattern-reversal visual evoked potentials(VEPs), somatosensory evoked potentials (SEPs),and motor evoked potentials (MEPs) were carriedout according to techniques described previously. (29-31) In brief, VEPs were obtained by pattern reversal tomonocular full-field stimulation using 30-minchecks, reversing at a rate of 3.1 Hz. The BAEPstudies were performed using monaural stimulationwith rarefaction clicks with a 10-ms duration at a rateof 11.1 Hz. The SEPs were elicited by unilateral per-cutaneous stimulation of the median nerve at athreshold of just above the motor threshold, and wererecorded from the brachial plexus (Erb potential), thecervical spine at C2 (N13), and the contralateral pari-etal area (N20) with a frontal (Fz) reference.containing the P2 promoter region was 5'TGTCCAGTTCATCCTGCCTCATTC3' and corre- sponded to nucleotides 486 to 509 of the Cx32gene. The PCR DNA products were purified using (30) a JETsorb kit (GENOMED) and were used as thetemplate for the DNA sequencing by the dideoxy DNA sequencing method (Thermo Sequenase cyclesequencing kit, Amersham). Molecular???genetic??analysis RESULTS The human Cx32 gene contains 2 tissue-specificpromoters, P1 and P2, which function in the liverFamily??pedigree and nervous system, respectively.(32) CMTX muta- There was no consanguinity among the 4 gener-ation of family members evaluated. Analysis of thepedigree showed a segregation pattern in generationIII. All 5 daughters (III-2, III-4, III-5, III-6, and III-8) but none of the 23 sons (III-1, III-3, or III-7) oftions in the coding region of the Cx32 gene can leadto functional impairment of Cx32 gap junctions, andin the P2 promoter, to reduced Cx32 expression inmyelinated Schwann cells. Table?1.?Summary of Clinical, Nerve Conduction Velocity (NCV), and Genetic Studies in Generations II, III, and IVClinical and NCV studies No. of patients with an abnormal neurologicGenetic studyGenerationNo. of total patientsNo. of patientsNo. of patients with an abnormal NCV studyNo. of patientsNo. of patients with mutationsexamination 1 (II-2) 5 (62.5%)II III9 82 (II-1,2) 81 (II-2) 5 (62.5%)2 (II-1, 2) 8 (III-1~8)1 (II-2) 5 (62.5%)(III-1~8) 15(III-2, 4, 5, 6, 8) 3 (20%)(III-2, 4, 5, 6, 8) 2 (13.3%)(III-2, 4, 5, 6, 8) 3 (42.9%)IV297 (IV-1~7)(IV-1~15)(IV-3, 4, 7)(IV-4, 7)(IV-3, 4, 7)Chang Gung Med J Vol. 27 No. 7 July 2004 ? Tony Wu, et al492A Taiwanese family with CMTX and ptosis the affected father (II-2) had clinical pictures ofCMT. There was no male-to-male transmissionobserved. These features suggested CMT in this fam-ily, probably with an X-linked dominant pattern ofinheritance. Hyperthyroidism was noted in the mem-bers of generations II, III, and IV, probably withdominant transmission. The presence of hyperthy-roidism was an independent feature in this CMTfamily. The unusual combination of CMT and famil-ial hyperthyroidism in this family was caused bymarriage between a man (II-2) with inherited neu-ropathy and a woman (II-1) with familial hyperthy-roidism. Table?2.?Clinical Features of Affected Family MembersPedigree no. and genderAge (yr) at examinationNeuropathyPtosis HyperthyroidismI-1 (F) * II-1 (F)*+ - + - + - + + + + + + -? - + - + - + + + + -? + - + + + + - + - - - + -72 72 53 51 46 43 39 37 31 20 15 16 14II-2 (M)III-1 (M)III-2 (F)III-3 (M)III-4 (F)III-5 (F)III-6 (F)III-8 (F)IV-3 (F)IV-4 (M)IV-6 (F)IV-7 (M)Clinical and electrophysiological findings Twenty-five family members (II-1 and II-2, III-1 through III-8, and IV-1 through IV-15) received a full neurological examination and electrophysiological - - ++*: Clinical data from the history; +: presence; -: absence; ?: unknown.Table?3.?Clinical Features of Neuropathy in Probable CMTX PatientsPatientAge (yr)GenderOnset (yr)InitialsymptomHandWeaknessThighLegPes cavusAreflexiaSensoryimpairmentPtosisOphthal-moplegiaArmII-2 III-2 III-4 III-5 III-6 III-8 IV-3 IV-4 IV-772 51 43 39 37 31 20 15 14M F FFFFFMM30s 20s 20s 30s 21 20s 19 13GGPGPGGGG++++++-+++-++-+++--+-++++++++++++------++++++-+ + + + + + -mild mild severemild severemild -- - + - + - -- -- -- -- -- -- mild- -12Abbreviations:?G: gait disturbance; P: ptosis. +: presence of clinical signs; -: absence of clinical signs.Table?4.?Nerve Conduction Studies in Patients with Probable CMTXAge (yr)Gender Onset (yr)Peroneal A (mV)(motor)MNCVTibial(motor)MNCVSuralMedianA (mV)(motor)MNCVMedianA (µV)(sensory)Ulnar(motor)Ulnar (sensory)PatientA (mV)A (µV)SNCVA (mV)MNCV A (µV)SNCVII-272 51 43 39 37 31 20 15 14M F F F F F F M M30s20s20s30s21 20s19 13NR 0.20.70.12.70.22.92.72.7-NR 0.50.21.13.61.33.54.64.0-4.04.84.02.23.0NR 18.0 5.04.61.86.536 33 43 46 51 45 57 52 5124 17 18 10 37 20 25 14 1943 47 53 53 49 56 61 50 504.3 3.4 7.6 6.7 9.2 6.6 9.4 8.2 8.236 44 50 45 43 49 60 50 5325 20 13 17 33 25 22 10 1743 50 56 48 51 52 62 50 51III-2 III-4 III-5 III-6 III-8 IV-3IV-4IV-7Controls34 35 43 36 33 53 42 4229 34 40 31 30 50 42 417.211.110.19.08.7 7.41215.0> 3.9> 41 > 4.5 > 42 > 11.0 > 6.6> 49> 13> 57 > 6.5> 53 > 11 > 52Abbreviations:?A: distal motor or sensory amplitude; MNCV: motor nerve conduction velocity (m/s); SNCV: sensory nerve conduction velocity (m/s); NR: no response.Chang Gung Med J Vol. 27 No. 7 July 2004 ? 493Tony Wu, et alA Taiwanese family with CMTX and ptosisTable?5.?Thyroid Function in Patients with HyperthyroidismPatientAge (yr)GenderAge (yr) at Thyroid- ThyroidT3 (ng/dl)T4 (µg/dl)TSH (µIU/ ml) crosomal AbAntimi-TBII ND Currenttreatment and endocrineOtherdiagnosisof HT 60sectomyscanthyroid status thyroxin,euthyroidhypothyroidATD,anomaly NIDDMII-172F60sND< 10< 1.045.41:6400(+)III-1 III-253 51M F30s 4830s NDND DI77.0 2096.0 > 24.97.2 < 0.1ND 1:6400(+)ND 40.3 %none noneeuthyroidhypothyroideuthyroidATD,III-3 III-4 III-6 46 43 37M F F37 26 3437 26 and 27 NDND ND DI59.457.4320.04.2 5.9 17.67.62.8< 0.1ND ND 1:100(+)ND ND 27.7 %noneNIDDMnoneeuthyroid hyperthyroidIV-716F16NDND22114.1< 0.1NDNDnoneNormal limits52-1754.8-12.80.4-4.5< 15 %Abbreviations:???HT: hyperthyroidism; ND: not done; DI: diffusely increased; TBII: TSH-binding inhibitory immunoglobulin;ATD: anti-thyroid drug; NIDDM: non-insulin-dependent diabetic mellitus.Table?6.?Evoked Potential Studies in Patients with Probable CMTX (ms)MEP ADM CMCT8.47.87.27.67.66.8NDSEPMedian N13-N20 5.45.75.15.75.15.15.7 PatientAge (yr)72 51 43 39 37 31 20GenderOnset(yr)30s 20s 20s 30s 21 20s 19 13TA CMCT15.612.414.014.414.014.0NDTibial N22-P40 - - 14.4- 17.4- - ND 16.8< 6.4BAEP latencies III NRVEP latencyI NRVRightNR 99 108 95LeftNR 100 109 97II-2M F F F F F F M M6.2 5.5 5.6 5.5 5.7 5.8 5.5 ND 5.6III-2 III-4 III-5 III-6 III-8 IV-3 IV-4 IV-71.6 1.6 1.5 1.5 1.5 1.63.8 3.6 3.6 3.6 3.8 3.7104 104 100 ND 104104 104 100 ND 10515 147.6 9.6 < 20.515.4 16.0 < 2.0ND 6.0 < 4.5NDND12 < 8.12.24.4Controls < 10.2 < 18.6< 112< 112Abbreviations:?MEP: motor evoked potential; SEP: somatosensory evoked potential; EAEP: brainstem auditory evoked potential; VEP: visual evoked potential; ADM: abductor digiti minimi; TA: tibialis anterior; CMCT: central motor conduction time;NR: no response: absence of N22 response; ND: not done.studies. The general results of clinical, electrophysio-logical, and genetic studies are summarized in Table1. Their clinical features are summarized in Table 2.The onset and distribution of neuropathic findingsare shown in Table 3. The results of NCV studies areshown in Table 4. Mean MNCVs in the median,ulnar, tibial, and peroneal nerves and mean SNCVsin the median, ulnar, and sural nerves were uniformlyreduced. Mean CMAPs and SNAPs were normal inthe arms, but mildly reduced in the lower legs. Thefindings of the thyroid function tests are shown inTable 5 and of the evoked potential studies in Table 6. Case??III?6 The propositus, a 35-year-old woman, came toour clinic for ptosis, which had not improved aftermedical treatment and a thymectomy at the age of 20years. A neck goiter was noted at the age of 34 years,and thyroid function tests revealed hyperthyroidismwith T3 of 320 (normal, 52 -175) ng/dl, T4 of 17.6(normal, 4.8-12.8) µg/dl, and TSH of <0.1 (normal,0.4- 4.5) µIU/ml. A Tc-99m thyroid scan showed dif-fusely increased uptake. She was treated with propy-lthiouracil and propranolol, and remained in aneuthyroid status. An examination revealed severeptosis, external ophthalmoplegia, diffuse hyporeflex-Chang Gung Med J Vol. 27 No. 7 July 2004 ? Tony Wu, et al494A Taiwanese family with CMTX and ptosis ia, a flexor plantar response, decreased distal sensa-tion, and mild distal weakness in the extremities.There was no pes cavus or peroneal muscle atrophy.Her ptosis did not show diurnal fluctuations.Intramuscular injection of 10 mg edrophonium chlo-ride produced no improvement in the ptosis. Serumacetylcholine receptor antibodies were absent.Repetitive stimulation tests in the abductor pollisbrevis, deltoid, and orbicularis oculi muscles at 3 Hzproduced no amplitude decrement of the motorresponses. Electroneurography revealed normal orslightly slowed motor nerve conduction velocities(MNCVs) of the median (51 m/s), ulnar (43 m/s),peroneal (36 m/s), and tibial (31 m/s) nerves.Sensory nerve conduction velocity (SNCV) studiesshowed mildly slowed SNCV of the median (49 m/s)and ulnar (51 m/s) nerves. The amplitudes of com-pound muscle action potentials (CMAPs) of the per-oneal (2.7 mV) and tibial (3.6 mV) nerves, and sen-sory nerve action potentials (SNAPs) of the sural (3µV) nerve were reduced. The amplitudes of CMAPsand the SNAPs of the median and ulnar nerves werenormal. Electromyography (EMG) revealed chronicneurogenic changes that were more prominent in thedistal muscles. Brainstem auditory evoked potential(BAEP) and pattern-reversal visual evoked potential(VEP) studies were normal. Somatosensory evokedpotential (SEP) and motor evoked potential (MEP)studies demonstrated normal central sensory andmotor conduction velocities. Peripheral conductionof the SEPs had a delayed N9 latency of 11.4 (nor-mal, < 10.9) ms to median nerve stimulation and adelayed N22 latency of 27.6 (normal, <24.1) ms totibial nerve stimulation. MEPs to magnetic stimula-tion over the cervical and lumbar spinal columnrevealed normal peripheral motor conduction to theabductor digiti minimi of 14.4 (normal, < 15.9) ms,but mildly slowed peripheral motor conduction to thetibialis anterior of 14.8 (normal, <14.6) ms.severe ptosis (Fig. 2A), external ophthalmoplegia,pes cavus, distal muscle atrophy, decreased distalsensation, diffuse hyporeflexia, and the absence ofBabinski's sign. A thyroid function test revealed aeuthyroid status. MNCVs were mildly slowed for themedian (43 m/s), ulnar (50 m/s), peroneal (35 m/s),and tibial (34 m/s) nerves. SNCVs were also mildlyslowed for the median nerve (53 m/s) but were nor-mal for the ulnar nerve (56 m/s). Repetitive stimula-tion test in the abductor pollis brevis, deltoid, andorbicularis oculi muscles at 3 Hz produced no decre-ment in the motor responses. EMG revealed diffusechronic neurogenic changes particularly in the distalmuscles. The BAEP and VEP studies were normal.The SEP and MEP studies revealed normal centralsensory and motor conduction velocities. Peripheralconduction in the SEP study revealed a delayedlatency of the N9 of 11.7 (normal, < 10.9) ms tomedian nerve stimulation and delayed latency of theN22 of 28.2 (normal <24.1) ms to tibial nerve stimu-lation. MEPs to magnetic stimulation over the cervi-cal and lumbar spinal column had normal peripheral motor conduction to the abductor digiti minimi of14.4 (normal, < 15.9) ms but slowed peripheralmotor conduction to the tibialis anterior of 17.8 (nor-mal, < 14.6) ms. A sural nerve biopsy showed adecreased number of large myelinated fibers andclusters of thinly myelinated regenerating fibers.Morphometric analysis revealed a normal density ofmyelinated fibers (6810 fibers/mm ). The axon diam- 2 eter histogram was unimodal with a loss of largemyelinated fibers and a concomitant increase insmaller-sized fibers, reflecting the prominent numberof thinly myelinated sprouts. Ultrastructural exami-nation revealed some axons with inappropriately thinmyelin sheaths in relation to axon diameter in a clus-ter of regenerating fibers. No onion bulb formationor giant axonal swelling was noted. Single teasedfiber examination confirmed the absence of paran-odal or segmental demyelination and remyelination.The above histopathologic findings were consistentwith axonal neuropathy. Her 14-year-old son (IV-7)had had gait abnormality and right ptosis (Fig. 2B)since the age of 12 years. An examination revealedmild pes cavus, weakness of foot dorsiflexion, dif-fuse hyporeflexia, and decreased distal sensation.Extraocular movement and thyroid function werenormal. Her 16-year-old daughter (IV-6) had abnor-mal thyroid function tests with T3 of 221 (normal,Case III-4 This 52-year-old woman had noted ptosis sincethe age of 25 years and gait disturbance since the ageof 30 years. These symptoms slowly progressed tothe point that she had drop foot and severe ptosisover the past 6 years. She was diagnosed as havinghyperthyroidism at the age of 26 years, and hadtwice received a thyroidectomy at the ages of 26 and27 years, respectively. An examination showedChang Gung Med J Vol. 27 No. 7 July 2004 ? 495Tony Wu, et alA Taiwanese family with CMTX and ptosis A B Fig.?2??(A) Severe ptosis of case III-4; (B) mild right eye ptosis of case IV-7 (son of case III-4). 52- 175) ng/dl, T4 of 14.1 (normal, 4.8-12.8) µg/dl,and TSH of <0.2 (normal, 0.4-4.5) µIU/ml. She hada normal neurological examination and NCV study.thy and ptosis when she was in her 20's. IV-3 hadnoted mild leg weakness at 19 years of age. A neuro-logical examination revealed diffuse hyporeflexia,mild weakness on feet dorsiflexion, and mildlydecreased distal sensation. IV-4, a 15-year-old male,had experienced mild gait abnormality for 2 years.An examination showed pes cavus, weakness on footdorsiflexion, diffuse hyporeflexia, and decreased dis-tal sensation. Neither IV-3 nor IV-4 had ptosis orexternal ophthalmoplegia, and their thyroid functiontests were normal. Other family members Cases I-1, II-3, and II-4 were reported to haveabnormal gait according to their histories. II-2 hadnoted pes cavus, drop foot, and mild ptosis since hewas in his 30s. A neurological examination revealedptosis, steppage gait, pes cavus, diffuse hyporeflexia,distal muscle atrophy, weakness in the extremities,decreased distal sensation, and hearing impairment.He had normal mental function, and could still walkwithout assistance. Thyroid function tests revealed aeuthyroid status. II-1 had hyperthyroidism and hadreceived a thyroidectomy at the age of 60 years.Unfortunately, she developed symptoms of myxede-ma, cold intolerance, thin hair, hoarseness, andunsteady gait thereafter. Thyroid function testsrevealed hypothyroidism with T3 of < 10 (normal,52- 175) ng/dl, T4 of <1.0 (normal, 4.8-12.8) µg/dl,and TSH of 45.4 (normal, 0.4 - 4.5) µIU/ml. Thesymptoms and signs of hypothyroidism had beencorrected with thyroxin treatment since she was 70years old. She had a normal neurological examina-tion and NCV study. III-1 had hyperthyroidism andhad received a thyroidectomy when he was in his30s. III-3 also had hyperthyroidism and had receiveda thyroidectomy at the age of 37 years. Both III-1and III-3 had normal neurological examinations andthyroid function tests. III-2 had had peripheral neu-ropathy and ptosis since she was in her 20s, and hadbeen diagnosed as having hyperthyroidism at the ageof 48 years. III-5 was noted to have ptosis andperipheral neuropathy in a family screening. Theneurological examination, as well as thyroid functionand nerve conduction studies were all normal in III-7. III-8 had noted symptoms of peripheral neuropa-Molecular genetic findings Direct sequencing of the PCR DNA productrevealed that the Cx32 coding region of 9 affectedmembers exhibited no mutation. Instead, analysis ofthe PCR products revealed that CMT patients had aG-to-A point mutation at position -215 relative to thetranscription initiation site in the nerve-specific Cx32P2 promoter. This mutation occurred in male (II-2, (24) IV-4, and IV-7) and heterozygous female (III-2, III-4,III-5, III-6, III-8, and IV-3) CMT patients, but wasnot present in unaffected family members. The G-to-A transfusion in the P2 promoter is located 200 basepairs (bp) upstream of the TATA box. DISCUSSION Three genes commonly causing CMT encodemyelin-related proteins: peripheral myelin protein 22(PMP22), myelin protein zero (MPZ), and Cx32.PMP22 duplication mainly causes demyelinatingphenotypes with variable axonal features. Patientswith MPZ mutations fall into 2 distinctive phenotyp-ic subgroups: one showing preserved MNCV andexclusively axonal pathological features, with theother exhibiting exclusively demyelinating features.Patients with Cx32 mutations show intermediateChang Gung Med J Vol. 27 No. 7 July 2004 ? Tony Wu, et al496A Taiwanese family with CMTX and ptosis slowing of MNCVs, predominantly axonal features,and relatively mild demyelinating pathologies.of the CMT phenotype by Ionassescu, the clinical (15) features of this family should be classified as a mod-erate CMT phenotype characterized by weakness ofthe peroneals and tibialis anterior (which requiredankle foot orthoses), weakness of the palmar anddorsal interossei, and ptosis. This is consistent with aprevious report of CMTX families with point muta-tions in promoter P2 of the Cx32 gene or 5' untrans-lated region of mRNA who had moderate CMT phe- The present study revealed distinct features oftypical peripheral sensorimotor neuropathy (CMT),ptosis, and hyperthyroidism in 4 generations of aTaiwanese family. Their clinical, electrophysiologi-cal, and pathological features in 9 affected memberswith hereditary neuropathy are consistent with thoseseen in axonal CMT. In addition to the classic clini-cal features of CMT, ptosis in this family was anunusual manifestation of a hereditary neuropathy.The family pedigree showed a segregation pattern inwhich all 5 daughters and none of the 3 sons of theaffected father (II-2) were affected. There was nomale-to-male transmission, and there were moreaffected females than males (6:3). The onset ages inmale patients (IV-4 and IV-7) were earlier than thosein female patients. This evidence suggests that CMTin this family has an X-linked dominant inheritancepattern. The young age (?10 years old) of the at-risk patients IV-8 ~ 15 may explain the low percentage(20%) of abnormal clinical and NCV findings ingeneration IV. A molecular genetic study confirmedthat this CMTX1 family had a G-to-A transition atposition -215 (in relation to the transcription initia-tion site) of nerve-specific promoter P2 of the Cx32gene. Analysis of the family pedigree indicated thatthe familial hyperthyroidism of probable dominanttransmission was an independent trait in this CMTX-afflicted family. The unusual combination ofCMTX1 and familial hyperthyroidism in this familywas caused by a marriage between a man with inher-ited neuropathy and a woman with familial hyperthy-roidism. notypes. Mutations of the P2 promoter may direct- (15) ly affect the rate of initiation of transcription andmay decrease production of the Cx32 protein. Previous reports of CMTX families withdetailed clinical, electrophysiological, and histologi-cal descriptions produced no consensus concerningthe type of neuropathy manifested. Some considerCMTX to primarily be an axonal neuropathy,whereas others concluded it to primarily be ademyelinating neuropathy. In this family, median(3,18-20,35)(21,23) MNCVs were normal or slightly reduced (? 45 m/s) in 6 of the 9 CMTX patients, and 4 of them had nor-mal peroneal MNCVs. All of the CMTX patients hadreduced CMAP amplitudes and MNCVs exceeding30 m/s in the peroneal nerve. These NCV features suggest axonal damage more than a myelinopathy,and differ from results of a previous study of familieswith mutations in the noncoding regions of the Cx32gene who had MNCVs which ranged from 20 to 30m/s, although no details were given of the nervestested.(15) From the aspect of the evoked potentialstudy, patients with CMT of the demyelinating typeusually have increased wave I latency of the BAEPor prolongation of the P100 peak latency inVEPs. In the present family, all except for case (33,36-40) Most CMTX families have distinct mutations inthe Cx32 gene, and more than 160 mutations of theII-2 among CMT patients had normal BAEP andVEP studies. Patient II-2 lacked a wave I but had anormal wave V peak latency in BAEP, while lackingthe P100 waveform in the VEP study. These evokedpotential characters suggest that the involvement ofcochlear and optic nerves is mainly due to axonopa-thy. Furthermore, the histological features includingmorphological findings, morphometry, and electronmicroscopic examination also support primary axon-al damage being responsible for the neuropathy inthis probable CMTX family. Cx32 gene coding region have been identified.(17,33) The severity of the CMTX clinical phenotype is cor-related with both the location and type of mutation inthe Cx32 gene. Most missense mutations show (14) mild clinical phenotypes, whereas nonsense muta-tions normally cause severe CMT phenotypes.(14) Families with CMTX without mutations in the openreading frame may have mutations in the Cx32 pro-moter, splice sites, or untranslated regions.(15) The present family might be the third CMTX familyreported to possess mutations in the noncodingregion of the Cx32 gene although another study had In peripheral nerves, connexin32 has beendemonstrated in the Schmidt-Lanterman incisuresand the paranodal portions of the node ofa different opinion.(34) According to the classification Ranvier.(41-43) In the central nervous system, connex- Chang Gung Med J Vol. 27 No. 7 July 2004 ? 497Tony Wu, et alA Taiwanese family with CMTX and ptosis in32 is expressed throughout the internodal region aswell as in oligodendrocytes. The exact mechanismman with neuropathy and a woman with hyperthy-roidism. This is similar to previous reports of con-current CMT and myotonic dystrophy, facioscapulo-humeral muscular dystrophy, or nephropathy in sin-(41) through which CMTX patients experience predomi-nant disturbance of the peripheral myelin and to alesser extent the central myelin is unknown. A possi-ble explanation is that several other connexinsexpressed in the central nervous system may substi-tute for Cx32's function. Impairment of the centralnervous system has been demonstrated in evokedpotential and brain MRI studies from some CMTXgle family groups. (25-27) Several studies have described unusual clinicalassociations of ptosis and CMT similar to those inthis family. ptosis or ophthalmoplegia may mimic ocular myas-thenia gravis. Although myasthenia gravis as a(54,55) Patients with CMT presenting with(56) families.(23,33,44,45) Patients with mutations in the coding cause of ptosis was considered in our patients, all 7patients with neuropathy and ptosis had negativerepetitive stimulation and edrophonium tests. A ther-apeutic trial of pyridostigmine in the 2 patients withsevere ptosis and external ophthalmoplegia (III-4 andIII-6) was unsuccessful. The propositus had ptosis asan initial presentation and underwent a thymectomy.She had subsequent intermittent physostigmine treat-ment for more than 10 years; however, she had nega-tive repetitive stimulation and edrophonium tests,and acetylcholine receptor antibodies were unde-tectable. Therefore, myasthenia gravis cannot beconsidered as the cause of ptosis in this family.Ptosis is an accompanying feature of CMTX, andmay manifest before the classical signs of hereditaryneuropathy as in patients III-4 and III-6. Twoyounger CMTX patients (IV-3 and IV-4) presentingwith the symptom of mild gait abnormality for only1 or 2 years may develop ptosis at some future point. In conclusion, the presence of ptosis in this fam-ily illustrates the existence of clinical heterogeneityamong related family members with CMTX similarto that in CMT of autosomal inheritance.Electrophysiological and histological features sup-port primary axonal damage being responsible forthe neuropathies in this family. Multimodalityevoked potentials studies revealed normal centralmotor and sensory conduction velocities, with thepossible involvement of the auditory and opticnerves. Familial hyperthyroidism is an independentfeature in this probable CMTX family. Further cellu-lar and molecular biology studies are essential toexamine the influence of the genetic background onvariations of CMTX phenotypes. region of the Cx32 gene show prolonged wave I-V interpeak latencies in BAEP, delayed P100 peaklatencies in VEPs, and increased central motor con-duction times in MEPs.(23,45,46) This may represent a functional defect of central gap junctions by domi-nant negative effects, in that chimeric connexins withmutant and wild-type connexins cannot properly beinserted into the cytoplasmic membrane.(47) On the other hand, mutation of the nerve-specific promoterP2 of the Cx32 gene may decrease the production ofCx32 protein without the formation of chimeric con-nexins. This might explain why our patients withprobable CMTX had normal central sensory, motor,and auditory conductions in the SEP, MEP, andBAEP studies. Thyrotoxic sensorimotor polyneuropathy is aninfrequent neuromuscular complication of hyperthy-(48-51) Clinical and electrophysiological fea-roidism. tures of thyrotoxic polyneuropathy may mimic thoseof CMT. Patients with thyrotoxic polyneuropathypresent symptoms mostly affecting the legs(Basedow's paraplegia). ies are normal or mildly slowed in the lower and nerve biopsies show features ofaxonal neuropathy. Thyrotoxic polyneuropathyusually presents in the later stages of hyperthy-roidism and improves with medical treatment.(48,50) Nerve conduction stud- limbs,(48,50,51)(50,52)(50,53) In the present family, none of the 3 patients with bothneuropathy and hyperthyroidism (III-2, III-4, and III-6) showed any improvement in the neuropathicsymptoms following medical treatment or a thy-roidectomy. Two (III-2 and III-6) of them had neu-ropathy which had occurred much earlier than thetime at which they had been diagnosed as havinghyperthyroidism. The polyneuropathy in this familywas not secondary to hyperthyroidism. The unusualcombination of CMTX and familial hyperthyroidismin this family was caused by the marriage between aAcknowledgments This work was supported by funds from theNational Science Council (NSC86-2314-B-182A-Chang Gung Med J Vol. 27 No. 7 July 2004 ? Tony Wu, et al498A Taiwanese family with CMTX and ptosis 057) and Department of Health (DOH87-HR-740) ofthe R.O.C. tein in the PNS and CNS. J Neurosci 1995:15:8281-94.13. Dermietzel R, Spray DC. From neuro-glue to glia: a pro-logue. Glia 1998;24:1-8. 14. Ionasescu V, Ionasescu R, Searby C. Correlation betweenconnexin32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy. Am JMed Genet 1996;63:486-91. 15. Ionasescu VV, Searby C, Ionasescu R, Neuhaus IM,Werner R. Mutations of the noncoding region of the con-nexin32 gene in X-linked dominant Charcot-Marie-Toothneuropathy. Neurology 1996;47:541-4. REFERENCES 1. Dyck PJ, Lambert EH. Lower motor and primary sensoryneuron disease with peroneal muscular atrophy. I.Neurogenic, genetic, and electrophysiologic findings inhereditary polyneuropathies. Arch Neurol 1968;18:603-18. 2. Dyck PJ, Lambert EH. Lower motor and primary sensoryneuron disease with peroneal muscular atrophy. II.Neurogenic, genetic, and electrophysiologic findings inhereditary polyneuropathies. Arch Neurol 1968;18:619-25. 3. Hahn AF. Hereditary motor and sensory neuropathy:HMSN type II (neuronal) and X-linked HMSN. BrainPathol 1993;3:147-55. 16. Scherer SS, Fischbeck KH. Is CMTX an axonopathy?[letter]. Neurology 1999;52:432-3. 17. Dubourg O, Tardieu S, Birouk N, Gouider R, Leger JM,Maisonobe T, Brice A, Bouche P, LeGuern E. Clinical,electrophysiological and molecular genetic characteristicsof 93 patients with X-linked Charcot-Marie-Tooth dis-ease. Brain 2001:124:1958-67. 18. Tan CC, Ainsworth PJ, Hahn AF, MacLeod PM. Novelmutations in the connexin32 gene associated with X-linked Charcot-Marie-Tooth disease. Hum Mutat 1996;7:167-71. 4. Ionasescu VV. Charcot-Marie-Tooth neuropathies: fromclinical description to molecular genetics. Muscle Nerve1995;18:267-75. 5. Lupski JR, de Oca-Luna RM, Slaugenhaupt S, Pentao L,Guzzetta V, Trask BJ, Saucedo-Cardenas O, Barker DF,Killian JM, Garcia CA. DNA duplication associated withCharcot-Marie-Tooth disease type 1A. Cell 1991; 66:219-32. 19. Timmerman V, De Jonghe P, Spoelders P, Simokovic S,Lofgren A, Nelis E. Linkage and mutation analysis ofCharcot-Marie-Tooth neuropathy type 2 families withchromosomes 1p35-p36 and Xq13. Neurology 1996;46:1311-8. 6. Dubourg O, Tardieu S, Birouk N, Gouider R, Leger JM,Maisonobe T, Brice A, Bouche P, LeGuern E. The fre-quency of 17p11.2 duplication and connexin32 mutationsin 282 Charcot-Marie-Tooth families in relation to themode of inheritance and motor nerve conduction velocity.Neuromuscul Disord 2001;11:458-63. 7. Kamholz J, Menichella D, Jani A, Garbern J, Lewis RA,Krajewski KM, Lilien J, Scherer SS, Shy ME. Charcot-Marie-Tooth disease type 1: molecular pathogenesis togene therapy. Brain 2000;123:222-33. 8. Bergoffen J, Scherer SS, Wang S, Scott MO, Bone LJ,Paul DL, Chen K, Lensch MW, Chance PF, FischbeckKH. Connexin mutations in X-linked Charcot-Marie-Tooth disease. Science 1993;262:2039-42. 9. Fairweather N, Bell C, Cochrane S, Chelly J, Wang S,Mostacciuolo ML, Monaco AP, Haites NE. Mutations inthe connexin32 gene in X-linked dominant Charcot-Marie-Tooth disease (CMTX1). Hum Mol Genet 1994; 3:29-34. 20. Phillips LH, Kelly TE, Schnatterly P, Parker D.Hereditary motor-sensory neuropathy (HMSN): possibleX-linked dominant inheritance. Neurology 1985;35:498-502 21. Birouk N, LeGuern E, Maisonobe T, Rouger H, GouiderR, Tardieu S, Gugenheim M, Routon MC, Leger JM,Agid Y, Brice A, Bouche P. X-linked Charcot-Marie-Tooth disease with connexin32 mutations: Clinical andelectrophysiologic study. Neurology 1998;50:1074-82.22. Rozear MP, Pericked-Vance MA, Fischbeck KH, StajichJM, Gaskell PC, Krendel DA. Hereditary motor and sen-sory neuropathy, X-linked: a half century follow-up.Neurology 1987;37:1460-5. 23. B(hr M, Andres F, Timmerman V, Nelis ME. VanBroeckhoven C. Dichgans J. Central visual, acoustic, andmotor pathway involvement in a Charcot-Marie-Toothfamily with an Asn205Ser mutation in the connexin32gene. J Neurol Neurosurg Psychiatry 1999;66:202-6.24. Wang, HL, Wu T, Chang WT, Li AH, Chen MS, Wu CY,Fang W. Point mutation associated with X-linked domi-nant Charcot-Marie-Tooth disease impairs the P2 promot-er activity of human connexin-32 gene. Brain Res MolBrain Res 2000;78:146-53. 10. Ionasescu VV, Searby C, Ionasescu R. Point mutations ofthe connexin32 (GJB1) gene in X-linked dominantCharcot-Marie-Tooth neuropathy. Hum Mol Genet 1994;3:355-8. 11. Bone LJ, Dahl N, Lensch MW, Chance PF, Kelly T, LeGuern E, Magi S, Parry G, Shapiro H, Wang S. New con-nexin32 mutations associated with X-linked Charcot-Marie-Tooth disease. Neurology 1995;45:1863-6. 12. Scherer SS, Deschenes SM, Xu YT, Grinspan JB,Fischbeck KH, Paul DL. Connexin-32 myelin-related pro-25. Gherardi R, Belghiti-Deprez D, Hirbec G, Bouche P. WeilB. Lagrue G. Focal glomerulosclerosis associated withCharcot-Marie-Tooth disease. Nephron 1985;40:357-61.26. Spaans F, Jennekens FGI, Mirandolle JF, Bijlsma JB, DEGast GC. Myotonic dystrophy associated with hereditarymotor and sensory neuropathy. Brain 1986;109:1149-68.Chang Gung Med J Vol. 27 No. 7 July 2004 ? 499Tony Wu, et alA Taiwanese family with CMTX and ptosis27. Bergmann C, Senderek J, Hermanns B, Jauch A, JanssenB, Schroder M, Karch D. Becker muscular dystrophycombined with X-linked Charcot-Marie-Tooth neuropa-thy. Muscle Nerve 2000;23:818-23. 28. Huang CC, Chu CC, Wu TN, Shih TS, Chu NS. Clinicalcourse in patients with chronic carbon disulfide polyneu-ropathy. Clin Neurol Neurosurg 2002;104:115-20. 29. Yang SS, Chu NS, Liaw YF. Brainstem auditory evokedpotentials in hepatic encephalopathy. Hepatology 1986;6:1352-5. three gap junction proteins in developing and maturebrain tissues. Proc Natl Acad Sci USA 1989;88:10148-52.42. Dermietzel R, Spray DC. Gap junctions in the brain:where, what type, how many and why? Trends Neurol Sci1993;16:186-92. 43. Spray DC, Dermietzel R. X-linked dominant Charcot-Marie-Tooth disease and other potential gap-junction dis-eases of the nervous system. Trends Neurosci 1995;18:156-62. 44. Bell C, Willison H, Clark C. CNS abnormalities in a fami-ly with a connexin32 mutation and peripheral neuropathy.Eur J Hum Genet 1996;4(suppl 1):136. 30. Chu NS. Sensory evoked potentials in Wilson's disease.Brain 1986;109:491-507. 31. Chu NS, Wu T. Motor evoked potentials in acute cerebralinfarction: correlations with muscle strength, Babinskisign, and hyperreflexia. J Neurol Rehabil 1991;5:181-6.32. Neuhaus IM, Bone L, Wang S, Ionasescu VV, Werner R.The human connexin-32 gene is transcribed from two tis-sue-specific promoters. Biosci Report 1996;16:239-48.33. Lee M-J, Nelson I, Houlden H, Sweeney MG, Hilton-Jones D, Blake J, Wood NW, Reilly MM. Six novel con-nexin32 (GJB1) mutations in X-linked Charcot-Marie-Tooth disease. J Neurol Neurosurg Psychiatry 2002;73:304-6. 34. Bergmann C, Zerres K, Rudnik-Schoneborn S,Eggermann T, Schroder JM, Senderek J. Allelic variantsin the 5' non-coding region of the connexin32 gene: possi-ble pitfalls in the diagnosis of X linked Charcot-Marie-Tooth neuropathy (CMTX). J Med Genet 2002;39:e58.35. Senderek J, Bergmann C, Quasthoff S, Ramaekers VT.Schroder JM. X-linked dominant Charcot-Marie-Toothdisease: nerve biopsies allow morphological evaluationand detection of connexin32 mutations (Arg15Trp,Arg22Gln). Acta Neuropathol 1998;95:443-9. 45. Nicholson GA, Yeung L, Corbett A. Efficient neurophysi-ologic selection of X-linked Charcot-Marie-Tooth fami-lies. Neurology 1998;51:1412-6. 46. Hisama FM, Lee HH, Vashlishan A, Tekumalla P, RussellDS, Auld EPA, Goldstein JM. Clinical and molecularstudies in a family with probable X-linked dominantCharcot-Marie-Tooth disease involving the central ner-vous system. Arch Neurol 2001;58:1891-6. 47. Omori Y, Mesnil M, Yamasaki H. Connexin32 mutationfrom X-linked Charcot-Marie-Tooth disease patients:functional defects and dominant negative effects. MolBiology Cell 1996;7:907-16. 48. Ludin HP, Spiess H, Koenig MP. Neuromuscular dysfunc-tion associated with thyrotoxicosis. Eur Neurol 1969;2:269-78. 49. McComas AJ, Sica RE, McNabb AR, Goldberg WM.Upton AR. Neuropathy in thyrotoxicosis (letter). N Engl JMed 1973;289:219-20. 50. Feibel JH, Campa JF. Thyrotoxic neuropathy (Basedow'sparaplegia). J Neurol Neurosurg Psychiatry 1976;39:491-7. 36. Carroll WM, Jones SJ, Halliday AM. Visual evokedpotential abnormalities in Charcot-Marie-Tooth diseaseand comparison with Friedreich's ataxia. J Neurol Sci1983;61:123-33. 51. Berlit P, Mahlberg U, Usadel KH. Polyneuropathy inhyperthyroidism-a clinical neurophysiologic study.Schweizer Archiv Fur Neurologie Und Psychiatrie 1992;143:81-90. 37. Gadoth N, Gordon CR, Bleich N, Pratt H. Three modali-ties of evoked potentials in Charcot-Marie-Tooth disease(HMSN-I). Brain Dev 1991;13:91-4. 52. Szollar SM, Czyrny JJ, Heffner RR Jr. Neurologic com-plications of thyrotoxicosis: case report. Arch Phy MedRehab 1988;69:41-3. 38. Scaioli V, Parevson D, Avanzini C, Sghirlanzoni A.Response and somatosensory and brainstem auditoryevoked potential studies in HMSN types I and II. J NeurolNeurosurg Psychiatry 1992;55:1027-31. 53. Fisher M, Mateer JE, Ullrich, Gutrecht JA. Pyramidaltract deficits and polyneuropathy in hyperthyroidism:combination clinically mimicking amyotrophic lateralsclerosis. Am J Med 1985;78:1041-4. 39. Nicholson G, Corbett A. Slowing of central conduction inX-linked Charcot-Marie-Tooth neuropathy shown bybrain stem auditory evoked responses. J NeurolNeurosurg Psychiatry 1996;61:43-6. 40. Marques WJR, Sweeney MG, Wood NW, Wroe SJ,Marques W. Central nervous system involvement in anovel connexin32 mutation affecting identical twins. JNeurol Neurosurg Psychiatry 1999;66:803-4. 54. Stephens J, Hoover ML, Denst J. On familial ataxia, neur-al amyotrophy, and their association with progressiveexternal ophthalmoplegia. Brain 1958;81:556-66. 55. Tandan R, Taylor R, Adesina A, Sharma K, Fries T,Pendlebury W. Benign autosomal dominant syndrome ofneuronal Charcot-Marie-Tooth disease, ptosis, parkinson-ism, and dementia. Neurology 1990;40:773-9. 56. Spector RH, Smith JL, Chavis PS. Charcot-Marie-Toothdisease mimicking ocular myasthenia gravis. AnnOphthalmol 1978;10:1033-6. 41. Dermietzel R, Traub O, Hwang TK, Beyer E, BennettMV, Spray DC, Willecke K. Differential expression ofChang Gung Med J Vol. 27 No. 7 July 2004 ? 500 Charcot?Marie?Tooth (CMTX) 123 Charcot-Marie-Tooth (CMTX) CMTX connexin32 (Cx32,Cx32 32) 9 Charcot-Marie-ToothCx32 coding region promoter P2 -215 G A (axonal) CMTX ( ?????2004;27:489-500)Charcot-Marie-Tooth32 ??????????Δ???????????1????????2?Δξ????????????3??????????Δ??????????????????????92?10?14???????????93?5?13??????О?????????????????? ??????????333????????5??Tel: (03)3281200?8418; Fax: (03)3287226; E-mail: tonywu@adm.cgmh.org.tw