nprot.2007.528

MicroRNA detection by northern blotting using locked nucleic acid probes E´va Va´rallyay, Jo´zsef Burgya´n & Zolta´n Havelda Agricultural Biotechnology Center, Plant Virology Group, Szent-Gyo¨rgyi Albert ut 4, Go¨do¨llo˜ H-2100, Hungary. Correspondence should be addressed to Z.H. (havelda@abc.hu). Published online 17 January 2008; doi:10.1038/nprot.2007.528 MicroRNAs (miRNAs) are short, about 21 nucleotides in length, noncoding, regulatory RNA molecules representing a new layer in post-transcriptional regulation of gene expression. Intensive miRNA research has necessitated the development of effective miRNA detection methods such as northern analyses, quantitative real-time PCR and microarrays. Northern analysis is a widely used method for miRNA analyses because it is generally a readily available technology for laboratories and does not require special equipment and technical knowledge. The major disadvantages of the northern blot technology using the traditional DNA oligonucleotide probes are its poor sensitivity and the high time consumption. Here, we describe an improved protocol for miRNA northern blot analysis, which includes RNA extraction, polyacrylamide gel electrophoresis and northern blotting, and the hybridization and detection of locked nucleic acid (LNA)-modified oligonucleotide probes. The use of LNA-modified oligonucleotide probes allows highly sensitive and specific detection of mature miRNAs and also dramatically reduces the period of time necessary for carrying out the protocol. Using this approach, the hybridization, washing and signal-detection steps can be performed ideally in 4 h. INTRODUCTION miRNA-mediated regulation processes play a central role in the growth and development of plants and animals. miRNAs are generated by sequential processing of genome-encoded, long, single-stranded RNA molecules possessing the ability to form highly structured stem–loop structures. The recent discovery of miRNA-controlled gene regulatory mechanisms has had a signifi- cant impact on the understanding of developmental processes in both plants and animals. Since then, several hundred miRNAs have been identified in diverse species and deposited in miRNA data- bases, and the importance of this regulatory network is becoming more and more important. Understanding their precise role requires reliable detection of their accumulation during the devel- opmental program. However, the detection of miRNAs is techni- cally demanding because of their small size. The most straightforward approach to assess the role of a particular miRNA in a biological process is the analysis of the accumulation level of mature miRNAs in the investigated samples. Several alternative technological approaches have been employed to investigate miRNA accumulation. The principle of quantitative real-time PCR is based on the quantitative relationship between the amount of target miRNA and the amount of PCR product1,2. This approach requires small amounts of starting material and can provide accurate results; however, it requires careful primer design and also special equipment and expertise. Microarray analysis of miRNA accumulation provides the advantage of high throughput; however, it also requires special tools and expertise3. Probably the most simple and widespread approach to assess the accumulation of target miRNAs is polyacrylamide gel electrophoresis of RNA samples combined with northern blot analysis. The advantage of this technique is that it does not require any special equipment or expertise and allows both quantitation of the expression level of miRNA and determination of the size of the RNA. Traditionally, DNA oligonucleotide probes complementary to the target miRNAs have been used in northern blot experiments for analysis of small RNAs. The main problem in using DNA oligonucleotide probes is their poor sensitivity, which is especially pronounced when investigating miRNAs of low abundance. On these occasions, large amounts of purified total RNA samples must be generated, which is not feasible when the cell or tissue source is limited. To avoid this problem, we have developed a new method based on LNA-modified oligonucleotide probes4 (Fig. 1a). LNA monomers are bicyclic, high-affinity RNA analogues pos- sessing a modified ribose moiety5. The furanose ring in the sugar– phosphate backbone is chemically locked in an N-type (C3¢-endo) conformation by the introduction of a 2¢-O–4¢-C methylene bridge, resulting in enhanced base stacking and phosphate backbone pre-organization6. DNA oligonucleotides modified by the intro- duction of LNAs at every third nucleotide position are used in the northern blotting method for analysis of small RNAs described here4. The mismatch discrimination power of oligonucleotide probes increased after LNA modification, demonstrated by the use of single and double mismatched LNA probes4 (Fig. 1b). The sensitivity of the detection of miRNAs by LNA-modified oligonu- cleotide probes in northern blot experiments has also been shown to increase dramatically in comparison to traditional DNA probes (see Fig. 2b). As LNA-modified oligonucleotide probes are very stable and their chemical properties are very similar to DNA oligonucleotides, they can be easily incorporated into standard laboratory procedures. LNA-modified oligonucleotide probes detecting miRNAs can be ordered from Exiqon (http://www. exiqon.com) and a website for probe design is also available (http://lnatools.com). Here, we describe the step-by-step protocol of northern blotting for analysis of small RNAs, emphasizing the advantage of LNA- modified oligonucleotide probes in miRNA detection. Using LNA- modified oligonucleotide probes in northern blot experiments for analysis of small RNAs provides reliable, sensitive and rapid detection of mature miRNAs from even limited amounts of RNA samples from any organism. The protocol described here is very simple and does not require any expensive equipment or special expertise. As LNA-modified oligonucleotide probes can also be used for in situ hybridization7,8, the data gained during northern p u or G g n ih si lb uP er u ta N 800 2 © n at ur ep ro to co ls / m oc . er ut a n . w w w//:ptth 190 | VOL.3 NO.2 | 2008 | NATURE PROTOCOLS PROTOCOL blot hybridization can also be used to establish experiments to perform spatial analyses of target miRNAs. Although LNA- modified oligonucleotide probes cost significantly more than tradi- tional DNA oligonucleotides, their superior performance compensates for the increased expenses associated with this technique. Experimental design RNA extraction. Commercially available RNA extraction solu- tions, such as Trizol (Invitrogen) or TRI reagent (Sigma), should be used for purifying RNA samples. Here, we describe the steps of RNA extraction using TRI reagent (Sigma); however, it is always impor- tant to follow the description of manufacturer. RNA extraction method based on mini column should not be used because this can lead to the loss of the small-RNA fraction of the total-RNA samples. As RNA molecules can be degraded rapidly at room temperature by RNases, it is very important to use sterile reagents and consumables and to keep the RNA samples on ice during the procedure. High- quality, intact RNA extract is a prerequisite for reliable and effective detection of miRNAs. It is very important to assess the quality and quantity of the extracted RNA sample by agarose gel electrophoresis before its application in miRNA analyses. Choice and design of probe. Conventional DNA oligonucleotide probes are suitable for miRNA detection, but the sensitivity of radiolabeled DNA probes is often not sufficient. To enhance the sensitivity of the hybridization, LNA-modified probes can be used. As the LNA-modified and traditional DNA oligonucleotide probes are chemically very similar, the same labeling reaction can be applied. LNA-modified oligonucleotides can be designed and purchased from Exiqon (http://www.exiqon.com and http://lnatools.com). Controls. For interpretation of the hybridization results, it is always good to have appropriate positive and negative controls. For the negative control, a similar amount of RNA sample from a different source where the target miRNA is not present should be used (e.g., plant RNA extract if animal miRNA is to be detected). In this protocol, RNA extract from mouse liver has been used, as there are no plant miRNAs in this RNA source. The negative control will detect the potential nonspecific background hybridization. As a positive control, an RNA sample that is a known source of the target miRNA or a synthetic miRNA should be used. The positive control will show the efficiency of the particular hybridization experiment. MATERIALS REAGENTS .Trizol (Invitrogen, cat. no. 15596-026) or TRI reagent (Sigma, cat. no. T9424) .Liquid nitrogen (optional) .Chloroform (Sigma, cat. no. C2432) . Isopropyl alcohol (Sigma, cat. no. I9030) .70% (vol/vol) ethanol (diluted from 99.8% ethanol; Aldrich, cat. no. 24,511-9) .Agarose UltraPure (Invitrogen, cat. no. 15510-019) .Tris (Sigma, cat. no. T4661) p u or G g n ih si lb uP er u ta N 800 2 © n at ur ep ro to co ls / m oc . er ut a n . w w w//:ptth 40 20 10 5 2.5 1.25 0.5 M 20 30 40 50 60 1 2 3 1 2 3 1 2 3 6h a bµg Total RNA m iR1 71 MM 2 m iR1 71 MM 1 m iR1 71 2 × O/N Figure 1 | Assessment of the sensitivity and specificity of miRNA detection using LNA-modified oligonucleotide probes. (a) Arabidopsis thaliana total RNA from 40–0.5 mg was electrophoresed on 12% polyacrylamide gel under denaturing conditions, blotted and hybridized with 32P-labeled LNA-modified oligonucleotide probes detecting miR171. The gel loading controls are shown from ethidium bromide staining of the rRNAs (bottom panels). M, molecular weight marker. (b) Specificity of LNA probes in the detection of miR171 in A. thaliana flowers and leaves. Total RNAs (10 mg per sample) from A. thaliana flowers (lane 1), leaves (lane 2) and mouse liver (negative control; lane 3) were run on 12% polyacryl- amide gel under denaturing conditions, blotted and hybridized at 60 1C for 3 h with 32P-labeled miR171 LNA (GATATTGGCGCGGCTCAATCA) probe that matches the target sequence, and with miR171 LNA probes containing one (mir171MM1; GATATTGGCGAGGCTCAATCA) and two (mir171MM2; GATATTGGCGAAGCTCAATCA) mismatches to the target sequence (underlined). The membranes were washed twice at the temperature of hybridization with 2� SSC, 0.1% SDS for 10 min. The membranes were exposed for 6 h and subsequently for 2 d. The gel loading controls are shown from ethidium bromide staining of the rRNAs (bottom panel). Figure 2 | Assessment of the concentration and type of probe for miRNA detection. (a) Total RNAs (10 mg per sample) from A. thaliana flowers (lane 1), leaves (lane 2) and mouse liver (negative control; lane 3) were electrophoresed on 12% polyacrylamide gel under denaturing conditions, blotted and hybridized with either 1 pmol or 10 pmol of 32P-labeled miR171 LNA at 50 1C for 2 h. The membranes were washed twice at the temperature of hybridization with 2� SSC, 0.1% SDS for 10 min. The gel loading controls are shown from ethidium bromide staining of the rRNAs (bottom panel). (b) Improved sensitivity in the detection of miR171 in A. thaliana flowers and leaves using LNA probes compared to traditional DNA probe. Total RNAs (10 mg per sample) from A. thaliana flowers (lane 1), leaves (lane 2) and mouse liver (negative control; lane 3) were electrophoresed on 12% polyacrylamide gel under denaturing conditions, blotted and hybridized with miR319- (relatively less-abundant miRNA) detecting LNA probe (at 50 1C for 2 h) or DNA probe (at 37 1C for 16 h). The membranes were washed twice at the temperature of hybridization with 2� SSC, 0.1% SDS for 10 min. The gel loading controls are shown from ethidium bromide staining of the rRNAs (bottom panel). 1 pmol 10 pmol 6 h 1 2 3 1 2 3 1 2 3 1 2 3 a bmiR171 2 × O/N miR319 LNA probeDNA probe 2 × O/N NATURE PROTOCOLS | VOL.3 NO.2 | 2008 | 191 PROTOCOL .Boric acid (Fluka, cat. no. 15665) .EDTA (Sigma, cat. no. E5134) .Formamide (Carlo Erba, cat. no. 452286) m CRITICAL You have to deionize it unless you buy a deionized form (see REAGENT SETUP). .AG 501-X8 (D) ion-exchange resin (Bio-Rad, cat. no. 142-6425) .Xylene cyanol (Sigma, cat. no. X4126) .Bromophenol blue (Sigma, cat. no. 11,439-1) .Ethidium bromide solution 10 mg ml�1 (Amresco, cat. no. X-328) .Acrylamide (Sigma, cat. no. A3553) and bisacrylamide (Sigma, cat. no. M7279) or 19:1 acrylamide/bisacrylamide solution (Sigma, cat. no. A2917) ! CAUTION Acrylamide and bisacrylamide are highly neurotoxic; when handling these chemicals, wear gloves. .Ammonium persulfate (APS) (Sigma, cat. no. A9164) .TEMED (Sigma, cat. no. T-8133) .Nytran N membrane (Whatman, cat. no. 10416196) .Sodium chloride (NaCl; Fluka, cat. no. 71636) .Sodium citrate (Na-citrate; Fluka, cat. no. 71402) .Synthetic RNAs m CRITICAL These are ordered if you want to detect miRNA of a certain size. .LNA-modified oligonucleotide (Exiqon) .T4 polynucleotide kinase (Fermentas, cat. no. EK0031) .[g-32P]ATP (Amersham, cat. no. PB218) .Decade marker (Ambion, cat. no. 7778) .Sodium hydrogen phosphate (NaH2PO4; Fluka, cat. no. 71636) .Sodium hydroxide (NaOH; Sigma, cat. no. S-8045) .Ficoll 400 (Sigma, cat. no. F4375) .Polyvinylpyrrolidone (Sigma, cat. no. P2307) .BSA (Sigma, cat. no. A2153) .50� Denhardt’s stock (Sigma, cat. no. D2532) .Herring sperm DNA (Roche, cat. no. 223-646) .Sodium dodecyl sulfate (SDS; Fluka, cat. no. 71725) .PerfectHyb Plus hybridization buffer (Sigma, cat. no. H7033) .Developer and fixing solutions for X-ray films EQUIPMENT .Tabletop coolable centrifuge .Microwave oven .UV transilluminator .Transverse gel electrophoresis apparatus .Gel holders and combs for transverse gel electrophoresis .Electrophoresis system for PAGE m CRITICAL We used Penguin system, but vertical protein gel electrophoresis systems most commercially available are also suitable. As several types of equipment are available for PAGE, always follow the manufacturers’ instructions. .High-capacity power supply for PAGE .Chromatography papers (Whatman 3MM Chr, cat. no. 3030917) .UV crosslinker (Amersham) .Quick Spin Column (Roche) .Hybridization oven with tubes m CRITICAL We used Hybaid shake ‘n’ stack (Thermo Electron Corporation). .X-ray film m CRITICAL This can be obtained from any supplier. .Hyperscreen intensifying screen (GE Healthcare) .Hypercassette autoradiography cassette (GE Healthcare) .Storage phosphor screen and cassette (GE Healthcare) m CRITICAL This is needed only if you want to use phosphorimage screen. .STROM imaging system (GE Healthcare) m CRITICAL This is needed only if you want to use phosphorimage screen. REAGENT SETUP 103 TBE buffer (0.9 M Tris, 0.9 M boric acid, 0.02 M EDTA; pH 8.0) 121.1 g Tris, 51.35 g boric acid and 3.72 g EDTA in 1 liter of H2O. After sterilization, it can be stored at room temperature (21 1C) for several months. FDE 10 ml deionized formamide, 200 ml of 0.5 M EDTA (pH 8.0), 10 mg xylene cyanol and 10 mg bromophenol blue. This should be frozen in aliquots and kept at �20 1C for up to 6 months. 40% (wt/vol) acrylamide/bisacrylamide (19:1) solution 130 g acrylamide and 10 g bisacrylamide in 500 ml H2O. After filtration through filter paper, store at 4 1C for several months. 10% APS solution Prepare in water and immediately freeze in aliquots for single use at �20 1C. FLS 10 ml deionized formamide and 200 ml of 0.5 M EDTA (pH 8.0); add xylene cyanol and bromophenol blue to get a faint blue solution. Store at 4 1C for several months. m CRITICAL High concentration of dye can interfere with separation of small RNA species. Deionization of formamide Put AG 501-X8 (D) (Bio-Rad) ion-exchange resin in formamide on a shaker. Mix it and put more resin until there is no change in color. Filter it through a normal filter paper and store it at 4 1C. 203 SSC (3 M NaCl and 0.3 M Na-citrate; pH 7.0) 525.9 g NaCl and 264.6 g Na-citrate in 3 liters of H2O. Store at room temperature for several months. 203 SSPE (1 M NaCl, 0.2 M Na-phosphate and 0.04 M EDTA; pH 7.4) 175.3 g NaCl, 27.6 g NaH2PO4 �H2O, 7.4 g EDTA, set the pH to 7.4 with solid NaOH. Store at room temperature for several months. 503 Denhardt’s Dissolve 5 g Ficoll 400, 5 g polyvinylpyrrolidone and 5 g BSA in 500 ml sterile water. Keep in aliquots at �20 1C. 2 mg ml�1 herring sperm DNA In 10 ml H2O warmed to 60–70 1C in a microwave oven, dissolve 20 mg herring sperm. Store it in aliquots at �20 1C. Small RNA hybridization buffer For 100 ml solution, mix 50 ml deionized formamide, 25 ml of 20� SSPE, 10 ml of 50� Denhardt’s solution, 5 ml of 10% SDS, 9 ml H2O. Boil 1 ml of 2 mg ml �1 herring sperm DNA for 2 min and add it to the solution. Store at room temperature for several months. PROCEDURE RNA extraction � TIMING 2–3 h 1| Freeze samples in liquid nitrogen and grind them to powder. m CRITICAL STEP An alternative homogenization protocol can be used. To avoid use of liquid nitrogen, ice-cold mortar and pestle can be used for homogenization of tissue samples. 2| Add 1 ml of TRI reagent during the homogenization and pipette into a 1.5 ml test tube. 3| Incubate at room temperature for 5 min. 4| Add 200 ml of chloroform and shake for an additional 15 s. m CRITICAL STEP Do not vortex the samples, only shake them by inverting the tubes 10–20 times. 5| Incubate the samples at room temperature for 5–10 min. 6| Centrifuge the sample for 15 min at 4 1C (12,000g) and transfer the aqueous phase to a new 1.5 ml test tube containing 500 ml of isopropyl alcohol for RNA precipitation. 7| Mix the contents in the tube and leave it to precipitate for 5–10 min at room temperature. 8| Pellet the RNA content of the samples by centrifugation (10 min at 4 1C, 12,000g). 9| Wash the RNA pellet in 1 ml of 70% (vol/vol) ethanol and centrifuge for 5 min at 4 1C, 12,000g. p u or G g n ih si lb uP er u ta N 800 2 © n at ur ep ro to co ls / m oc . er ut a n . w w w//:ptth 192 | VOL.3 NO.2 | 2008 | NATURE PROTOCOLS PROTOCOL 10| Discard the supernatant and air-dry the pellet. m CRITICAL STEP Do not use vacuum dryer, otherwise you will have difficulties dissolving the pellet. 11| Dissolve the pellet in 30–50 ml of sterile RNase-free water. ’ PAUSE POINT Keep the samples on ice or store them in a �70 1C freezer. Sample quality check � TIMING 1–2 h 12| For agarose gel electrophoresis, mix agarose (1.2% wt/vol) with 1� TBE and heat in a microwave oven until boiling. 13| Allow the solution to cool down (toB60 1C), add 2 ml of ethidium bromide (10 mg/ml) and pour it into a gel holder with a comb. 14| Put the solidified gel into an appropriate electrophoresis tank containing 1� TBE. 15| Make up the desired amount of RNA sample (2–5 ml) to 5 ml by adding sterile water and add 5 ml FDE. 16| Denature the RNA sample in FDE for 10 min at 65 1C, cool on ice and load onto the gel. 17| Run the gel between 80 and 100 V for 45 min and visualize the quality of the RNA samples on a UV transilluminator. No degradation products of the rRNAs should be observed. Preparation of denaturing PAGE � TIMING 2–4 h 18| Clean the vertical electrophoresis apparatus, glass plates, spacers and comb with detergent and rinse it with autoclaved water. m CRITICAL STEP Here, we describe the gel setup for Penguin electrophoresis system, 20 cm� 20 cm glass plate gel sandwich with 1.5 mm spacers. Thinner spacers can be used but the running conditions should be modified according to the size of the spacer. Smaller equipment can also be used but in this case the efficiency of separation might be reduced. 19| Weigh 40 g urea and add 8 ml of 10� TBE and 16–30 ml acrylamide/bisacrylamide (19:1) solution to get a final acrylamide concentration of 8–15% (