H7N9

Articles www.thelancet.com Published online April 25, 2013 http://dx.doi.org/10.1016/S0140-6736(13)60903-4 1 Human infections with the emerging avian infl uenza A H7N9 virus from wet market poultry: clinical analysis and characterisation of viral genome Yu Chen*, Weifeng Liang*, Shigui Yang*, Nanping Wu*, Hainv Gao, Jifang Sheng, Hangping Yao, Jianer Wo, Qiang Fang, Dawei Cui, Yongcheng Li, Xing Yao, Yuntao Zhang, Haibo Wu, Shufa Zheng, Hongyan Diao, Shichang Xia, Yanjun Zhang, Kwok-Hung Chan, Hoi-Wah Tsoi, Jade Lee-Lee Teng, Wenjun Song, Pui Wang, Siu-Ying Lau, Min Zheng, Jasper Fuk-Woo Chan, Kelvin Kai-Wang To, Honglin Chen, Lanjuan Li, Kwok-Yung Yuen Summary Background Human infection with avian infl uenza A H7N9 virus emerged in eastern China in February, 2013, and has been associated with exposure to poultry. We report the clinical and microbiological features of patients infected with infl uenza A H7N9 virus and compare genomic features of the human virus with those of the virus in market poultry in Zhejiang, China. Methods Between March 7 and April 8, 2013, we included hospital inpatients if they had new-onset respiratory symptoms, unexplained radiographic infi ltrate, and laboratory-confi rmed H7N9 virus infection. We recorded histories and results of haematological, biochemical, radiological, and microbiological investigations. We took throat and sputum samples, used RT-PCR to detect M, H7, and N9 genes, and cultured samples in Madin-Darby canine kidney cells. We tested for co-infections and monitored serum concentrations of six cytokines and chemokines.We collected cloacal swabs from 86 birds from epidemiologically linked wet markets and inoculated embryonated chicken eggs with the samples. We identifi ed and subtyped isolates by RT-PCR sequencing. RNA extraction, complementary DNA synthesis, and PCR sequencing were done for one human and one chicken isolate. We characterised and phylogenetically analysed the eight gene segments of the viruses in the patient’s and the chicken’s isolates, and constructed phylogenetic trees of H, N, PB2, and NS genes. Findings We identifi ed four patients (mean age 56 years), all of whom had contact with poultry 3–8 days before disease onset. They presented with fever and rapidly progressive pneumonia that did not respond to antibiotics. Patients were leucopenic and lymphopenic, and had impaired liver or renal function, substantially increased serum cytokine or chemokine concentrations, and disseminated intravascular coagulation with disease progression. Two patients died. Sputum specimens were more likely to test positive for the H7N9 virus than were samples from throat swabs. The viral isolate from the patient was closely similar to that from an epidemiologically linked market chicken. All viral gene segments were of avian origin. The H7 of the isolated viruses was closest to that of the H7N3 virus from domestic ducks in Zhejiang, whereas the N9 was closest to that of the wild bird H7N9 virus in South Korea. We noted Gln226Leu and Gly186Val substitutions in human virus H7 (associated with increased affi nity for α-2,6-linked sialic acid receptors) and the PB2 Asp701Asn mutation (associated with mammalian adaptation). Ser31Asn mutation, which is associated with adamantane resistance, was noted in viral M2. Interpretation Cross species poultry-to-person transmission of this new reassortant H7N9 virus is associated with severe pneumonia and multiorgan dysfunction in human beings. Monitoring of the viral evolution and further study of disease pathogenesis will improve disease management, epidemic control, and pandemic preparedness. Funding Larry Chi-Kin Yung, National Key Program for Infectious Diseases of China. Introduction Infl uenza A virus is subtyped on the basis of two surface proteins, haemagglutinin (H) and neuraminidase (N), which govern the viral lifecycle at cellular entry and release of virions. All subtypes of infl uenza A virus, from H1 to H16 and N1 to N9, are detected in wild water birds; H17N10 is found in bats.1 Although most infections with these subtypes are mild or asymptomatic in avian species, outbreaks in wild birds and poultry have been associated with highly pathogenic avian infl uenza H5, and outbreaks in poultry have been associated with H7 subtypes.1,2 Human infections are generally con fi ned to H1, H2, and H3 subtypes, because these subtypes have affi nity for host cell receptors containing α-2,6-linked sialic acid (which occur in human beings), whereas other avian infl uenza viruses generally pref erentially attach to avian host cell receptors, which contain α-2,3-linked sialic acid. Direct trans- mission of avian infl uenza viruses from domestic poultry to people have been documented only for the H5N1, H7N2, H7N3, H7N7, H9N2, and H10N7 subtypes.1,3–7 Human infec tions due to these subtypes were generally mild and manifested as conjunctivitis and upper-respiratory-tract infections, except for the Published Online April 25, 2013 http://dx.doi.org/10.1016/ S0140-6736(13)60903-4 *These authors contributed equally to this work State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, First Affi liated Hospital, College of Medicine, Zhejiang University, Hangzhou, China (Y Chen MD, W Liang MD, S Yang PhD, N Wu PhD, H Gao MD, J Sheng MD, H Yao PhD, J Wo PhD, Q Fang MD, D Cui PhD, Yu Zhang MD, H Wu PhD, S Zheng PhD, H Diao PhD, Prof L Li MD); Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Hangzhou, China (Y Chen, W Liang, S Yang, N Wu, H Gao, J Sheng, H Yao, J Wo, H Wu, H Diao, H Chen PhD, Prof L Li, Prof K-Y Yuen MD); Xiaoshan People’s Hospital, Hangzhou, China (Y Li MD); Huzhou Central Hospital, Huzhou, China (X Yao MD); Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou, China (S Xia MD, Ya Zhang PhD); and State Key Laboratory of Emerging Infectious Diseases, Department of Microbiology, University of Hong Kong, Hong Kong Special Administrative Region, China (K-H Chan PhD, H-W Tsoi MPhil, J L-L Teng PhD, W Song PhD, P Wang PhD, S-Y Lau MPhil, M Zheng MPhil, J F-W Chan FRCPath, K K-W To FRCPath, H Chen, Prof K-Y Yuen) Correspondence to: Prof Lanjuan Li, State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, First Affi liated Hospital, College of Medicine, Zhejiang University, 79 Qingchun Road, Hangzhou, 310003, China ljli@zju.edu.cn Articles 2 www.thelancet.com Published online April 25, 2013 http://dx.doi.org/10.1016/S0140-6736(13)60903-4 H5N1 subtype, which was associated with mortality of greater than 50%, and the H7N7 subtype, which has caused one death.1,4 Since February, 2013, a novel reassortant H7N9 virus associated with human deaths but no apparent outbreaks in poultry and wild birds has emerged in eastern China. We report on four patients with severe infection due to this H7N9 virus. We sequenced, characterised, and compared viral genomes from a patient and an epidemiologically linked wet market chicken isolate. Methods Patients and associated procedures Between March 7 and April 8, 2013, we included hospital inpatients if they had new-onset respiratory symptoms, unexplained radiographic infi ltrate, and laboratory-con fi rmed H7N9 virus infection at the First Affi liated Hospital, College of Medicine, Zhejiang University, Hangzhou; Xiaoshan People’s Hospital, Hanzhou; or Huzhou Central Hospital, Huzhou (all in China). This study was approved by the institutional Patient 1 Patient 2 Patient 3 Patient 4 Age (years) 39 68 64 51 Sex Male Male Male Female Ethnic origin Chinese (Han) Chinese (Han) Chinese (Han) Chinese (Han) Place of residence Zhejiang, China Zhejiang, China Zhejiang, China Zhejiang, China Contact history with poultry Occupational (chef) Slaughtered and cooked market live poultry Bought market live poultry Bought market live poultry Underlying medical disorders Chronic hepatitis B virus infection, gallstones Hypertension Chronic bronchitis Chronic rheumatic heart disease with aortic and mitral valve replacements Chronic smoker Yes Yes Yes No Presumed incubation period (days)* Uncertain 8 3 6 Presenting symptoms Temperature (°C) 39·5 39·5 39·4 39·7 Sore throat – – – – Rhinorrhoea – – – – Conjunctivitis – – – – Cough + + + + Sputum + + + + Haemoptysis + + – + Dyspnoea + + + + Nausea or vomiting – – – – Diarrhoea + – – – Abdominal pain + – – – Myalgia – – – + Fatigue + + – + Skin rash – – – – APACHE-II score 14 14 16 18 Time between onset of symptoms and initiation of oseltamivir (days) NA 15 6 27 Time between onset of symptoms and onset of respiratory failure (days) 14 9 3 10 Time between onset of respiratory failure and need for mechanical ventilation (days) 2 4 0 NA Time between mechanical ventilation and death (days) 4 NA 4 NA Antibiotics given Piperacillin–tazobactam, moxifl oxacin, imipenem–cilastatin, linezolid, sulfamethoxazole Cefoperazone–sulbactam, fl uconazole Cefoperazone–sulbactam, levofl oxacin, imipenem–cilastatin, linezolid Imipenem–cilastatin, cefoperazone– sulbactam, azithromycin Days after onset of symptoms on which intravenous methylprednisolone given (dosage) Days 15–18 (80 mg every 24 h) Days 15–23 (80 mg every 24 h days 15–19 and 40 mg every 24 h days 20–23) Days 4–7 (80 mg every 24 h) Days 13–33 (40 mg every 24 h days 13–15 and 30 mg every 24 h days 16–33) Days after onset of symptoms on which intravenous immunoglobulin given (dosage) NA Days 17–21 (20 g every 24 h) Days 6–7 (5 g every 24 h) NA + indicates the presence of a symptom, and – the absence. APACHE=acute physiology and chronic health evaluation. NA=not applicable. *The presumed incubation period is defi ned as the time between the last exposure to poultry and onset of symptoms. Table 1: Epidemiological and clinical features of patients with avian infl uenza A H7N9 virus infection Articles www.thelancet.com Published online April 25, 2013 http://dx.doi.org/10.1016/S0140-6736(13)60903-4 3 review board of the First Affi liated Hospital, College of Medicine, Zhejiang University (reference number 2013-131). We entered history; physical examination; and haemato logical, biochemical, radiological, and micro biological investigation results into a predesigned database. We recorded patients’ acute physiology and chronic health evaluation II (APACHE-II) scores8 and defi ned acute respiratory distress syn drome and multiorgan dysfunction syndrome on the basis of standard criteria.9,10 Presumed incubation period was defi ned as the time between last poultry exposure and onset of symptoms. All laboratory procedures for respiratory secretions have been previously reported.11 Briefl y, we used Taqman real- time RT-PCR under standard thermo cycling conditions to detect M, H7, and N9 genes. The primers that we used were M-forward (GAGTGGCTAAAGACAAGACCAATC), M-reverse (TTGGACAAAGCGTCTACGC), and M-probe (FAM-TCACCGTGCCCAGTGAGCGAG-BHQ1); H7-for- ward (AGAGTCATTRCARAATAGAATACAGAT), H7- reverse (CACYGCATGTTTCCATTCTT), and H7-probe (FAM-AAACATGATGCCCCGAAGCTAAAC-BHQ1); and N9-forward (GTTCTATGCTCTCAGCCAAGG), N9- reverse (CTTGACCACCCAATGCATTC) and N9-probe (HEX-TAAGCTRGCCACTATCATCACCRCC-BHQ1). The detection limit of the M, H7 and N9 RT-PCR assays was about 100 copies of RNA per mL. All samples were cultured with trypsin in the Madin-Darby canine kidney cell line for 7 days. We did immunofl uorescent antigen staining for infl uenza A nucleoprotein (D3 ultra 8 DFA, respiratory virus screening and identifi cation kit, Diagnostic Hybrid, OH, USA) under ultraviolet micros- copy (Eurostar III plus, Euroimmune AG, Lubeck, Germany) in cell cultures with positive cytopathic changes. RT-PCR was used to subtype for H1, H3, H5, H9, and H7. We assessed patients’ respiratory tract samples on admission by multiplex PCR (Luminex 200 System, Luminex, TX, USA); did ResPlex II v2.0 assays (Qiagen, Germany) to detect co-infection with respiratory syncytial virus, infl uenza B virus, parainfl uenza viruses 1–4, human metapneumo virus, enteroviruses, rhino virus, adenovirus, bocavirus, and coronaviruses NL63, HKU1, 229E, and OC43; and used PCR to detect co-infection with Mycoplasma pneumoniae and Chlamydophila pneumoniae.12 We investigated blood, sputum, or endotracheal aspirates and urine samples bacteriologically, as clinically indi cated. Initial urine samples were tested for pneumococcal and Legion- ella antigens by immuno chromatographic enzyme immuno assay (Binax NOW Streptococcus pneumoniae Urinary Antigen Test and Binax NOW Legionella Urinary Antigen Test, Binax, ME, USA). We used the Luminex enzyme immunoassay (Luminex, TX, USA) to monitor six diff erent serum cytokines or chemokines—namely, interferon γ, inter leukins 2, 4, 6, and 10, and tumour necrosis factor α (TNFα)—as a measure of host immunological responses. Procedures in poultry and genome characterisation Cloacal swabs were collected from 20 chickens, four quails, fi ve pigeons, and 57 ducks from six epidemi ologically linked wet markets (four in Hanzhou City and two in Huzhou City, Zhejiang) and stored in viral trans port medium. The collected samples were inoculated into embryonated chicken eggs and viral replication was detected by haemadsorption, which has been previously de scribed.13 We identifi ed and subtyped isolates by RT-PCR sequencing (we used H7-specifi c and N9-specifi c pri mers). RNA extraction, complementary DNA syn thesis, and PCR sequencing were done for one human and one chicken isolate.13 Sequencing was done with the BigDye Terminator v3.1 Cycle Sequencing Kit on the 3130xL Genetic Analyzer A B C D E F R Figure 1: Representative radiographic fi ndings of H7N9 infl uenza Chest radiograph of patient 1 taken 19 days after onset of symptoms, showing bilateral pulmonary infi ltrates of airspace consolidation (A); CT of patient 1 taken 13 days after onset of symptoms, showing consolidation of right middle lobe (B); chest radiograph of patient 2 taken 14 days after onset of symptoms, showing bilateral interstitial infi ltrate (C); and serial CTs of patient 4 taken 20 (D), 27 (E), and 35 (F) days after onset of symptoms, showing interval radiological improvement and resolution of bilateral ground glass changes. Articles 4 www.thelancet.com Published online April 25, 2013 http://dx.doi.org/10.1016/S0140-6736(13)60903-4 (Applied Biosystems, NY, USA). We characterised and phylogenetically analysed all eight gene segments of the patient’s and the chicken’s isolates together with virus sequence data available from GenBank. All sequences were assembled and edited with Lasergene 6.0 (DNASTAR, WN, USA); Bioedit 7 was used for alignment and analysis of aminoacid residues. We used the MEGA software package v5.05 (Center for Evolutionary Medicine and Informatics, Biodesign Institute, AZ, USA) to construct the phylogenetic trees of H, N, PB2, and NS genes on the basis of the neighbour-joining method, with Tamura-Nei model of nucleotide substitution. The nucleotide of the HA1 region was used for analysis. Bootstrap values from 1000 replicates were calculated to assess the reliability of the phylogenetic tree. Our gene sequences are deposited in GenBank (accession numbers KC885955-62 [human isolate], KC899666-73 [chicken isolate]). Role of the funding source The sponsors had no role in study design; data collection, analysis, or interpretation; or writing of the report. The corres ponding author had full access to all the data in the study and had fi nal responsibility for the decision to submit for publication. Results All four patients had history of poultry contact (table 1). The presumed incubation period ranged from 3 to 8 days (mean 5·8 days). Mean age was 56 years (table 1). None of the patients were obese and none had upper- respiratory-tract symptoms or conjunctivitis. All patients had fever, and lower-respiratory-tract symptoms (includ- ing dyspnoea, cough, and sputum), and one had prominent myalgia (table 1). Chest radiography and CT of all patients showed multilobar patchy consolidation and diff use alveolar opacities (fi gure 1A–1F). CT of patients 1 and 4 showed ground glass changes in some areas. Mean time between onset of symptoms and respira tory failure was 9 days. Three patients were given 75 mg oral oseltamivir twice daily after tests for H7N9 virus were positive, starting a mean of 16 days after onset of symptoms onset (table 1). All patients required respiratory support— oxygen given through nasal cannulae at presentation. Two patients needed non-invasive ventilation by con tinuous positive airway pressure, and three subsequently received mechan ical ventilation. Two patients received intra- venous immunoglobulin and all received intra venous methylprednisolone (table 1). Two patients (pa tients 1 and 3) died 4 days after intubation. The other two patients were recovering clinically and radiologically and had been successfully extubated at the time of writing (fi gure 1). 303 house hold or workplace contacts and 82 health-care workers with unprotected exposure to the four patients were put under medical surveillance but none of them became symptomatic after 14 days. Table 2 lists the results of laboratory investigations in the patients. All patients had pronounced lymphopenia at presentation. Total leucocyte counts were healthy or low at presentation, but leucocytosis with neutrophilia developed with disease progression. Three patients had thrombocytopenia at presentation. All patients’ coagu lation profi les were impaired and D-dimer concen- trations substantially increased with disease progression. The patients who died had persistent lymphopenia, renal impairment, and rising aspartate transaminase and Normal range Patient 1 Patient 2 Patient 3 Patient 4 Haemoglobin (g/dL) 131·0–172·0 138·0; 122·0 108·0 127·0 114·0; 91·0 Total white cells (×10⁹ cells per L) 4·0–10·0 2·2; 14·4 6·0; 13·4 5·6; 7·2 5·3; 37·3 Neutrophils (×10⁹ cells per L) 2·0–7·0 1·8; 11·6 5·3; 12·6 5·3; 6·7 5·1; 34·5 Lymphocytes (×10⁹ cells per L) 0·8–4·0 0·4 0·7; 0·5 0·2 0·1 Platelets (×10⁹ cells per L) 83·0–303·0 55·0 212; 148 91·0 54·0 Prothrombin time (s) 10·0–13·5 15·0; 17·0 12·7; 11·2 14·4; 15·1 29·9; 65·5 Activated thromboplastin time (s) 22·0–36·0 34·1; 43·5 23·1; 44·3 75·6 107·5 D-dimer (μg/L) 0·0–700·0 3320·0; 23 000·0 5810·0; 17 490·0 288·0; 1235·0 5010·0; 6800·0 Urea (mmol/L) 2·9–8·2 6·4; 22·7 7·7; 8·6 5·4; 14·0 4·6; 10·2 Creatinine (μmol/L) 59·0–104·0 94·0; 470·0 45·0; 47·0 54·0; 148·0 63·0 Bilirubin (μmol/L) 0·0–21·0 43·8; 64·2 11·0 13·0; 28·7 16·0; 31·0 Alanine aminotransferase (U/L) 5·0–40·0 134·0 57·0; 89·0 33·0; 96·1 12·0; 30·0 Aspartate aminotransferase (U/L) 8·0–40·0 199·0; 319·0 62·0 48·0; 87·2 32·0; 128·0 Lactate dehydrogenase (U/L) 109·0–245·0 495·0; 1140·0 434·0; 466·0 535·0; 607·4 452·0; 2178·0 Creatinine kinase (U/L) 38·0–174·0 2533·0 44·0 109·0; 119·1 96·0; 119·0 C-reactive protein (mg/L) 0·0–8·0 74·9; 92·2 10·5; 11·7 175·3 56·5; 149·4 Results for when the patients presented and the patients’ most abnormal result during disease progression are given. If the reading at presentation was the most abnormal reading, only one result is given. Table 2: Laboratory measurements in four patients with avian infl uenza A H7N9 virus infection Articles www.thelancet.com Published online April 25, 2013 http://dx.doi.org/10.1016/S0140-6736(13)60903-4 5 D-dimer concentrations. Hepatic aminotransferases, C-reactive protein, and creatine kinase or lactate dehydro- genase concentrations were increased in all patients at some stage of illness; derangement was worse in those who died. Overall, serum cytokine and chemokine concentrations were substantially higher in patient 3 (who died) than in patient